Transcript: Mouse XM_006513529.2

PREDICTED: Mus musculus ALX homeobox 1 (Alx1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Alx1 (216285)
Length:
2494
CDS:
459..1439

Additional Resources:

NCBI RefSeq record:
XM_006513529.2
NBCI Gene record:
Alx1 (216285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085337 CGGACACGCATTTGAAACAAA pLKO.1 1331 CDS 100% 5.625 7.875 N Alx1 n/a
2 TRCN0000085334 GCAATGGATAACTGCAACAAT pLKO.1 741 CDS 100% 5.625 7.875 N Alx1 n/a
3 TRCN0000013151 CGCCAATATTTCATGGGCCAT pLKO.1 1415 CDS 100% 2.160 3.024 N ALX1 n/a
4 TRCN0000435382 GATCCCTGAAAGGACTAAATA pLKO_005 1612 3UTR 100% 15.000 12.000 N Alx1 n/a
5 TRCN0000418232 AGGAGCACACCGCCAATATTT pLKO_005 1405 CDS 100% 15.000 10.500 N Alx1 n/a
6 TRCN0000430483 TGTAAAGTGATACCTGATAAA pLKO_005 1815 3UTR 100% 13.200 9.240 N Alx1 n/a
7 TRCN0000085333 GCTCTGTATTTGCATGGATAT pLKO.1 2026 3UTR 100% 10.800 7.560 N Alx1 n/a
8 TRCN0000085335 CCGAACTACCTTTACCAGTTT pLKO.1 863 CDS 100% 4.950 3.465 N Alx1 n/a
9 TRCN0000085336 GCGTGAACTATGGAATCACCA pLKO.1 682 CDS 100% 2.640 1.848 N Alx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07201 pDONR223 100% 90.6% 96.9% None (many diffs) n/a
2 ccsbBroad304_07201 pLX_304 0% 90.6% 96.9% V5 (many diffs) n/a
3 TRCN0000474424 CCCCCCTTTGCCAATTTCCAATTA pLX_317 47.8% 90.6% 96.9% V5 (many diffs) n/a
Download CSV