Transcript: Mouse XM_006513637.2

PREDICTED: Mus musculus oxysterol binding protein-like 8 (Osbpl8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Osbpl8 (237542)
Length:
7200
CDS:
515..3175

Additional Resources:

NCBI RefSeq record:
XM_006513637.2
NBCI Gene record:
Osbpl8 (237542)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105245 GCCTATTCATTGATGTGATAT pLKO.1 4747 3UTR 100% 13.200 18.480 N Osbpl8 n/a
2 TRCN0000105247 CGTTTGAAGAAAGTCGTGAAA pLKO.1 1886 CDS 100% 4.950 6.930 N Osbpl8 n/a
3 TRCN0000105249 AGATCGAAAGACAGCACTTTA pLKO.1 1449 CDS 100% 13.200 9.240 N Osbpl8 n/a
4 TRCN0000105248 CCAAGATTTGTACTCTGATAA pLKO.1 1474 CDS 100% 13.200 9.240 N Osbpl8 n/a
5 TRCN0000105246 GCAGTCTATTTGGGCAGTGAA pLKO.1 1156 CDS 100% 4.950 3.465 N Osbpl8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04665 pDONR223 100% 89% 95.7% None (many diffs) n/a
2 ccsbBroad304_04665 pLX_304 0% 89% 95.7% V5 (many diffs) n/a
3 TRCN0000465866 CCAGCAGTGCTCGCAGGGGAAGCC pLX_317 14.7% 89% 95.7% V5 (many diffs) n/a
Download CSV