Transcript: Mouse XM_006513699.3

PREDICTED: Mus musculus synapsin III (Syn3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Syn3 (27204)
Length:
8922
CDS:
397..2136

Additional Resources:

NCBI RefSeq record:
XM_006513699.3
NBCI Gene record:
Syn3 (27204)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513699.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093508 CGGCAGAGATTATATCATCGA pLKO.1 1467 CDS 100% 2.640 3.696 N Syn3 n/a
2 TRCN0000093505 CCATACAGACTGGTCAAAGTA pLKO.1 696 CDS 100% 5.625 3.938 N Syn3 n/a
3 TRCN0000093506 GTTGTGAGAAATGGCACCAAA pLKO.1 829 CDS 100% 4.950 3.465 N Syn3 n/a
4 TRCN0000093507 CATACAGAAGATTGGATCCAA pLKO.1 1275 CDS 100% 3.000 2.100 N Syn3 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4859 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513699.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01873 pDONR223 100% 87.7% 92.4% None (many diffs) n/a
2 ccsbBroad304_01873 pLX_304 0% 87.7% 92.4% V5 (many diffs) n/a
3 TRCN0000475371 GCTAAGTTTATGTTCCCTATCCCT pLX_317 19.6% 87.7% 92.4% V5 (many diffs) n/a
Download CSV