Transcript: Mouse XM_006513908.3

PREDICTED: Mus musculus carbohydrate sulfotransferase 11 (Chst11), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chst11 (58250)
Length:
5384
CDS:
224..1279

Additional Resources:

NCBI RefSeq record:
XM_006513908.3
NBCI Gene record:
Chst11 (58250)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513908.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103334 CCACGAACTCATCTACTGCTA pLKO.1 565 CDS 100% 2.640 3.696 N Chst11 n/a
2 TRCN0000103330 CGGCATGGTTAAGAATTATTT pLKO.1 1425 3UTR 100% 15.000 12.000 N Chst11 n/a
3 TRCN0000103331 CGATGTCAAGTTCGAGGAGTT pLKO.1 919 CDS 100% 4.050 3.240 N Chst11 n/a
4 TRCN0000103332 CGAAGTCTACAAACTGGACTT pLKO.1 1213 CDS 100% 0.405 0.324 N Chst11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513908.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000470969 AGCATCCGTTTTTAGTTGCCCGCT pLX_317 34.5% 81.8% 85.2% V5 (many diffs) n/a
2 ccsbBroadEn_08177 pDONR223 100% 81.7% 84.6% None (many diffs) n/a
3 ccsbBroad304_08177 pLX_304 0% 81.7% 84.6% V5 (many diffs) n/a
Download CSV