Transcript: Mouse XM_006513987.2

PREDICTED: Mus musculus hect domain and RLD 4 (Herc4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Herc4 (67345)
Length:
3669
CDS:
492..3278

Additional Resources:

NCBI RefSeq record:
XM_006513987.2
NBCI Gene record:
Herc4 (67345)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305703 ATACGGCATGTTTCGATATTA pLKO_005 2411 CDS 100% 15.000 21.000 N Herc4 n/a
2 TRCN0000040639 CCAATGAGATAGATGGAACAT pLKO.1 1759 CDS 100% 4.950 6.930 N Herc4 n/a
3 TRCN0000324052 CCAATGAGATAGATGGAACAT pLKO_005 1759 CDS 100% 4.950 6.930 N Herc4 n/a
4 TRCN0000040640 GCCTAATGAATTACAAGCTAT pLKO.1 2903 CDS 100% 4.950 6.930 N Herc4 n/a
5 TRCN0000305704 GTCCATCCTCATACAAGTATT pLKO_005 3447 3UTR 100% 13.200 9.240 N Herc4 n/a
6 TRCN0000040641 CCACAAGATATTGGTTCTGAA pLKO.1 1548 CDS 100% 4.950 3.465 N Herc4 n/a
7 TRCN0000040642 CCAGTGATCGAGTCTGTGAAT pLKO.1 2202 CDS 100% 4.950 3.465 N Herc4 n/a
8 TRCN0000353899 CCAGTGATCGAGTCTGTGAAT pLKO_005 2202 CDS 100% 4.950 3.465 N Herc4 n/a
9 TRCN0000040638 GCCCAGAATATCGTAGCTGTT pLKO.1 738 CDS 100% 4.050 2.835 N Herc4 n/a
10 TRCN0000324053 GCCCAGAATATCGTAGCTGTT pLKO_005 738 CDS 100% 4.050 2.835 N Herc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02913 pDONR223 100% 80.6% 85.5% None (many diffs) n/a
2 ccsbBroad304_02913 pLX_304 0% 80.6% 85.5% V5 (many diffs) n/a
3 TRCN0000470694 GCTTGAAGCTGGCGCGCCCGTGAT pLX_317 11.2% 80.6% 85.5% V5 (many diffs) n/a
Download CSV