Transcript: Mouse XM_006513991.3

PREDICTED: Mus musculus hect domain and RLD 4 (Herc4), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Herc4 (67345)
Length:
1927
CDS:
201..1841

Additional Resources:

NCBI RefSeq record:
XM_006513991.3
NBCI Gene record:
Herc4 (67345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040639 CCAATGAGATAGATGGAACAT pLKO.1 1468 CDS 100% 4.950 6.930 N Herc4 n/a
2 TRCN0000324052 CCAATGAGATAGATGGAACAT pLKO_005 1468 CDS 100% 4.950 6.930 N Herc4 n/a
3 TRCN0000040641 CCACAAGATATTGGTTCTGAA pLKO.1 1257 CDS 100% 4.950 3.465 N Herc4 n/a
4 TRCN0000040638 GCCCAGAATATCGTAGCTGTT pLKO.1 447 CDS 100% 4.050 2.835 N Herc4 n/a
5 TRCN0000324053 GCCCAGAATATCGTAGCTGTT pLKO_005 447 CDS 100% 4.050 2.835 N Herc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02913 pDONR223 100% 47.5% 49.7% None (many diffs) n/a
2 ccsbBroad304_02913 pLX_304 0% 47.5% 49.7% V5 (many diffs) n/a
3 TRCN0000470694 GCTTGAAGCTGGCGCGCCCGTGAT pLX_317 11.2% 47.5% 49.7% V5 (many diffs) n/a
Download CSV