Transcript: Mouse XM_006514024.3

PREDICTED: Mus musculus SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 (Smarcc2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smarcc2 (68094)
Length:
5154
CDS:
88..3543

Additional Resources:

NCBI RefSeq record:
XM_006514024.3
NBCI Gene record:
Smarcc2 (68094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514024.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434077 AGCAACGCACCGCTTACTAAA pLKO_005 292 CDS 100% 13.200 18.480 N Smarcc2 n/a
2 TRCN0000426230 GACGCTGACAGACGAGGTAAA pLKO_005 912 CDS 100% 10.800 15.120 N Smarcc2 n/a
3 TRCN0000428494 GCAAGGTGTGAGGTGGAATAG pLKO_005 4000 3UTR 100% 10.800 15.120 N Smarcc2 n/a
4 TRCN0000085539 CCCAGGAGTATCTAACATCTA pLKO.1 1517 CDS 100% 4.950 6.930 N Smarcc2 n/a
5 TRCN0000085542 CCCGATAGTTGATCCTGAGAA pLKO.1 2625 CDS 100% 4.950 6.930 N Smarcc2 n/a
6 TRCN0000085541 CGACACATTCAACGAGTGGAT pLKO.1 822 CDS 100% 2.640 3.696 N Smarcc2 n/a
7 TRCN0000433947 GTGGATCCCAGCGAGTGAAAT pLKO_005 729 CDS 100% 13.200 10.560 N Smarcc2 n/a
8 TRCN0000085540 CCCAAACTGCTAGGGAAATTA pLKO.1 535 CDS 100% 15.000 10.500 N Smarcc2 n/a
9 TRCN0000413866 AGGACCCTCAACACCTTATAC pLKO_005 1041 CDS 100% 13.200 9.240 N Smarcc2 n/a
10 TRCN0000416801 GCCTGTCACGACCTAACATTT pLKO_005 494 CDS 100% 13.200 9.240 N Smarcc2 n/a
11 TRCN0000085538 CCCTTCAGAATTACTGCATTT pLKO.1 3831 3UTR 100% 10.800 7.560 N Smarcc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514024.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06975 pDONR223 100% 88.6% 94.7% None (many diffs) n/a
2 ccsbBroad304_06975 pLX_304 0% 88.6% 94.7% V5 (many diffs) n/a
3 TRCN0000468652 TGATTTGTTTCGGCTACAATTTTA pLX_317 11.5% 88.6% 94.7% V5 (many diffs) n/a
Download CSV