Transcript: Mouse XM_006514075.3

PREDICTED: Mus musculus ring finger protein 126 (Rnf126), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf126 (70294)
Length:
1518
CDS:
99..890

Additional Resources:

NCBI RefSeq record:
XM_006514075.3
NBCI Gene record:
Rnf126 (70294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040891 CCTTTGGCATCTTCGACGATA pLKO.1 346 CDS 100% 4.950 6.930 N Rnf126 n/a
2 TRCN0000040888 GCTTTGAAATAAATGGACGTT pLKO.1 1264 3UTR 100% 2.640 3.696 N Rnf126 n/a
3 TRCN0000040889 GCTCCTCAATCAGTTTGAGAA pLKO.1 610 CDS 100% 0.495 0.693 N Rnf126 n/a
4 TRCN0000040890 CCCAGTGTGTAAAGAAGACTA pLKO.1 721 CDS 100% 4.950 3.465 N Rnf126 n/a
5 TRCN0000040892 GAGACCAGGAACACAGAGAAT pLKO.1 225 CDS 100% 4.950 3.465 N Rnf126 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000474843 CGTTCGACTCCGGGCTTTGCTAAC pLX_317 45.8% 73.5% 55% V5 (many diffs) n/a
2 ccsbBroadEn_08561 pDONR223 100% 73.5% 54.9% None (many diffs) n/a
3 ccsbBroad304_08561 pLX_304 0% 73.5% 54.9% V5 (many diffs) n/a
4 ccsbBroadEn_12242 pDONR223 100% 70.2% 53.9% None (many diffs) n/a
5 ccsbBroad304_12242 pLX_304 0% 70.2% 53.9% V5 (many diffs) n/a
6 TRCN0000468264 TGGCTCTGTAATTCAGATGTGTAG pLX_317 22.7% 70.2% 53.9% V5 (many diffs) n/a
Download CSV