Transcript: Mouse XM_006514112.3

PREDICTED: Mus musculus phytanoyl-CoA hydroxylase interacting protein-like (Phyhipl), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Phyhipl (70911)
Length:
1929
CDS:
324..1400

Additional Resources:

NCBI RefSeq record:
XM_006514112.3
NBCI Gene record:
Phyhipl (70911)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514112.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249025 TATGTACACGGCTTATCATTA pLKO_005 1088 CDS 100% 13.200 18.480 N Phyhipl n/a
2 TRCN0000257850 TAATTGCAGCATGAGTTAAAT pLKO_005 1786 3UTR 100% 15.000 10.500 N Phyhipl n/a
3 TRCN0000249024 ACCACGCCCAGGATGTCATTT pLKO_005 1237 CDS 100% 13.200 9.240 N Phyhipl n/a
4 TRCN0000249026 GCAGCGCCTTCCTCAACTAAA pLKO_005 1160 CDS 100% 13.200 9.240 N Phyhipl n/a
5 TRCN0000174821 GCCAAACATAACAAGACAGTT pLKO.1 1650 3UTR 100% 4.950 3.465 N Phyhipl n/a
6 TRCN0000175807 GTGAGAGAACACTATGGGAAT pLKO.1 861 CDS 100% 4.050 2.835 N Phyhipl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514112.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12821 pDONR223 100% 84.5% 90.2% None (many diffs) n/a
2 ccsbBroad304_12821 pLX_304 0% 84.5% 90.2% V5 (many diffs) n/a
3 TRCN0000467815 AGGGAGCTCCCAACTCAGTTTGGA pLX_317 35% 84.5% 90.2% V5 (many diffs) n/a
Download CSV