Transcript: Mouse XM_006514312.3

PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain containing 1B (Anks1b), transcript variant X21, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Anks1b (77531)
Length:
5163
CDS:
301..1683

Additional Resources:

NCBI RefSeq record:
XM_006514312.3
NBCI Gene record:
Anks1b (77531)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248243 ATTTATCGATGCGGCAAATAA pLKO_005 1323 CDS 100% 15.000 21.000 N Anks1b n/a
2 TRCN0000248242 GCGTGGGCTTCCAGTTATAAA pLKO_005 3472 3UTR 100% 15.000 10.500 N Anks1b n/a
3 TRCN0000248245 CCGAACATGAAATTCGTAATA pLKO_005 1355 CDS 100% 13.200 9.240 N Anks1b n/a
4 TRCN0000234649 CTCTCAACATTTGCCTATATC pLKO_005 1405 CDS 100% 13.200 9.240 N ANKS1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12309 pDONR223 100% 69.2% 74.3% None (many diffs) n/a
2 ccsbBroad304_12309 pLX_304 0% 69.2% 74.3% V5 (many diffs) n/a
3 TRCN0000474562 TCACTGTACAGTACAGTCAGCCCA pLX_317 16.7% 69.2% 74.3% V5 (many diffs) n/a
4 ccsbBroadEn_15926 pDONR223 0% 61.4% 61.8% None (many diffs) n/a
5 ccsbBroad304_15926 pLX_304 0% 61.4% 61.8% V5 (many diffs) n/a
6 TRCN0000481009 CTCTTATTGAGGCACTTGCCAGAA pLX_317 37.9% 61.4% 61.8% V5 (many diffs) n/a
Download CSV