Construct: ORF TRCN0000481009

Construct Description:

Construct Type:
ORF
Other Identifiers:
ORF007842.1_s317c1
Derived from:
ccsbBroadEn_15926
DNA Barcode:
CTCTTATTGAGGCACTTGCCAGAA
Epitope Tag:
V5
Notes:
No stop codon in insert

Originally Annotated References:

Gene:
ANKS1B (56899)

Vector Information:

Vector Backbone:
pLX_317
Pol II Cassette 1:
SV40-PuroR
Pol II Cassette 2:
EF1a-TRCN0000481009
Selection Marker:
PuroR
Visible Reporter:
n/a
Epitope Tag:
V5

Current transcripts matched by this ORF:

Taxon Gene Symbol Description Transcript Nuc. Match %[?] Prot. Match %[?] Match Diffs[?]
1 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204066.2 99.9% 99.7% 974C>G
2 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352191.2 92.8% 90% (many diffs)
3 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204067.1 87% 84.3% (many diffs)
4 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352203.2 85.9% 85.7% 1_171del;1137_1139delGCA;1148C>G
5 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352192.2 81.9% 78.7% (many diffs)
6 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352193.2 81.7% 78.5% (many diffs)
7 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352199.2 80.7% 78.2% (many diffs)
8 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204070.2 80.5% 78% (many diffs)
9 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352201.2 80.1% 79.9% 1_171del;452_453ins75;1070C>G
10 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352194.2 79.9% 79.7% (many diffs)
11 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352206.2 79.4% 79% (many diffs)
12 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204069.2 79.2% 78.8% (many diffs)
13 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449069.1 78.5% 78.4% 286_573del;1254_1256delGCA;1265C>G
14 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204079.2 77.2% 74.5% (many diffs)
15 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352208.2 77.1% 74.5% (many diffs)
16 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352222.2 77.1% 74.5% (many diffs)
17 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352219.2 77% 74.3% (many diffs)
18 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204065.2 76.9% 74.3% (many diffs)
19 human 56899 ANKS1B ankyrin repeat and sterile ... NM_020140.3 76% 70.1% (many diffs)
20 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449067.1 75% 74.9% 1_171del;456_638del;1328C>G
21 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449066.1 74.9% 74.7% 1_171del;457_642del;1331C>G
22 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352189.1 74.4% 74.3% (many diffs)
23 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352190.1 74.4% 74.3% 1_78del;364_651del;1340C>G
24 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449065.1 74.3% 74.1% (many diffs)
25 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449070.1 74.2% 70.9% (many diffs)
26 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352202.2 72.3% 69.4% (many diffs)
27 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352204.2 72.1% 69.3% (many diffs)
28 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352223.1 71.6% 65% (many diffs)
29 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352209.2 71% 66.9% (many diffs)
30 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352221.2 71% 66.9% (many diffs)
31 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204080.2 70.8% 66.7% (many diffs)
32 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352207.2 70.8% 66.7% (many diffs)
33 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449068.1 70.6% 67.6% (many diffs)
34 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352195.2 70% 69.9% 1_171del;456_740del;1430C>G
35 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352205.2 69.9% 69.8% 1_171del;457_744del;1433C>G
36 human 56899 ANKS1B ankyrin repeat and sterile ... NM_181670.4 69.9% 69.8% (many diffs)
37 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352198.2 69.7% 69.6% (many diffs)
38 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352197.1 68.1% 62.5% (many diffs)
39 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352210.2 66.9% 66.1% (many diffs)
40 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352225.2 66.7% 65.9% (many diffs)
41 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204068.2 66.2% 62.2% (many diffs)
42 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352196.1 66.1% 63.3% (many diffs)
43 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204081.1 65.4% 57.7% (many diffs)
44 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352200.2 64.1% 62.9% (many diffs)
45 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449064.1 61.2% 61.1% (many diffs)
46 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352217.2 53.1% 52.9% 0_1ins501;473C>G
47 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352211.2 52.9% 52.7% 0_1ins501;465_467delGCA;476C>G
48 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352212.2 52.9% 52.7% 0_1ins501;465_467delGCA;476C>G
49 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352218.2 52.9% 52.7% 0_1ins501;465_467delGCA;476C>G
50 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352220.2 52.9% 52.7% 0_1ins501;465_467delGCA;476C>G
51 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352224.2 52.9% 52.7% 0_1ins501;465_467delGCA;476C>G
52 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352213.1 47.6% 43.9% (many diffs)
53 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352214.1 47.6% 43.9% (many diffs)
54 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352216.1 47.6% 43.9% (many diffs)
55 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449063.1 41.8% 40.1% (many diffs)
56 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449060.1 41.2% 41.1% (many diffs)
57 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449062.1 41.2% 41.1% (many diffs)
58 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449061.1 38.8% 38.8% (many diffs)
59 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719513.4 28.8% 27.8% (many diffs)
60 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719512.4 28.8% 27.7% (many diffs)
61 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019656.2 28.5% 28.4% (many diffs)
62 human 56899 ANKS1B ankyrin repeat and sterile ... XM_011538571.3 28.5% 28.4% (many diffs)
63 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019657.2 28.4% 27.4% (many diffs)
64 human 56899 ANKS1B ankyrin repeat and sterile ... XM_005269029.5 27.9% 26.8% (many diffs)
65 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352185.1 27.8% 26.7% (many diffs)
66 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352187.1 27.8% 26.7% (many diffs)
67 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019652.2 27.8% 27.7% (many diffs)
68 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352188.1 27.7% 27.7% 1_2493del;2778_3062del;3752C>G
69 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719504.4 27.7% 27.7% (many diffs)
70 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719505.4 27.7% 27.7% 1_2493del;2779_3066del;3755C>G
71 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352186.1 27.7% 27.7% (many diffs)
72 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719514.4 27.3% 25.3% (many diffs)
73 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019658.2 27.2% 25.2% (many diffs)
74 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019654.2 26.4% 25.4% (many diffs)
75 human 56899 ANKS1B ankyrin repeat and sterile ... NM_152788.4 26.4% 24.3% (many diffs)
76 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019653.2 26.3% 25.3% (many diffs)
77 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719507.4 26.3% 25.3% (many diffs)
78 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719510.4 25.7% 24.2% (many diffs)
79 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019655.2 25.7% 25.3% (many diffs)
80 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719508.4 25.6% 25.2% (many diffs)
81 human 56899 ANKS1B ankyrin repeat and sterile ... XR_001748815.2 17.2% (many diffs)
82 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314157.1 76.2% 78% (many diffs)
83 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_181398.3 74.6% 77.3% (many diffs)
84 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514313.3 73.5% 78.2% (many diffs)
85 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001177398.1 73.3% 78.2% (many diffs)
86 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314161.1 71.5% 74.2% (many diffs)
87 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314162.1 71.5% 74.2% (many diffs)
88 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314158.1 71.2% 74% (many diffs)
89 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314159.1 71.2% 74% (many diffs)
90 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314160.1 71.2% 74% (many diffs)
91 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001177397.1 70.2% 70.3% (many diffs)
92 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001347053.1 65.5% 66.4% (many diffs)
93 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001347054.1 65.5% 66.4% (many diffs)
94 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001177396.1 64.9% 69.2% (many diffs)
95 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514312.3 61.4% 61.8% (many diffs)
96 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314156.1 41.3% 42.6% (many diffs)
97 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314154.1 26.1% 26.9% (many diffs)
98 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314152.1 26.1% 26.7% (many diffs)
99 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314153.1 26.1% 26.8% (many diffs)
100 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001128086.2 26% 26.6% (many diffs)
101 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314151.1 25.8% 27.6% (many diffs)
102 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314150.1 25.8% 27.5% (many diffs)
103 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314155.1 25.5% 25.9% (many diffs)
104 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514303.2 25.4% 25.9% (many diffs)
105 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514302.2 25.2% 26.8% (many diffs)
106 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314148.1 25.2% 26.8% (many diffs)
107 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514301.2 25.1% 26.8% (many diffs)
108 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514306.2 23.3% 23.4% (many diffs)
109 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514304.2 23.2% 24.3% (many diffs)
110 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314149.1 23% 24.3% (many diffs)
111 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514305.3 23% 24.3% (many diffs)
Download CSV

Sequence Information

Note: uppercase bases indicate empirically verified sequence.

ORF start:
66
ORF end:
1137
ORF length:
1071
Sequence:
1tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag
61ttggcatggc taatggattt gacaatgtgc agtttatggg aagcaatgtt atggaagatc
121aggatttgtt ggaaattgga atccttaatt ctgggcacag acaaagaatt ctacaggcaa
181tccagctcct tccaaagatg agacccattg ggcatgatgg ctaccatccc acctctgtag
241ctgagtggct ggattccatt gaactgggcg actacaccaa agcctttcta attaatggct
301acacttcgat ggacctgttg aaaaaaatct gggaggttga acttattaat cagtcgtctg
361tctgtgaaat atggacgaat cagaacgcag gatttccttt ctcagcgatc catcaggttc
421ataatacagg agactgggga gaaccttcca ttaccttgcg acctccgaat gaagccacag
481cctctacccc ggtacagtac tggcagcatc acccagaaaa gcttatcttc cagtcgtgtg
541attacaaagc tttttattta ggttctatgc tgataaaaga gcttaggggg acagaatcaa
601cccaagatgc ttgtgcaaaa atgcgggcta actgtcagaa gtctacagag caaatgaaga
661aggtccctac tattattctt tctgtctcat ataaaggagt caaatttatt gatgcaacaa
721ataagaacat aatTGCTGAG CATGAAATTC GTAATATCTC CTGTGCTGCC CAGGACCCAG
781AAGACCTCTC AACATTTGCC TATATCACAA AAGATTTGAA GTCTAATCAC CACTACTGTC
841ATGTGTTTAC TGCCTTTGAT GTGAATTTAG CCTATGAAAT CATCCTAACC CTGGGACAGG
901CATTCGAAGT CGCTTACCAG CTAGCACTAC AAGCAAGAAA AGGGGGACAC TCCTCCACAC
961TTCCAGAAAG CTTTGAAAAC AAACCCTCCA AACCCATCCC CAAGCCCCGC GTTAGCATTC
1021GCAAGTCCGT GATCGACCGA TCTGAGCAAA AGACTCTGGC CAATCTACCG TGGATTGTGG
1081AGCCGGGCCA AGAAGCCAAG AGGGGCATTA ATACCAAGTA TGAAACCACG ATTTTCTGCC
1141CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC
1201TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT
1261ATATATCTTG TGGAAAGGAC GACTCTTATT GAGGCACTTG CCAGAAACGC GTTAAGTCga
1321caatcaacct ctggattaca aaatttgtga aagatt

Download FASTA (ORF) (Full)