Construct: ORF TRCN0000474562

Construct Description:

Construct Type:
ORF
Other Identifiers:
ORF008836.1_s317c1
Derived from:
ccsbBroadEn_12309
DNA Barcode:
TCACTGTACAGTACAGTCAGCCCA
Epitope Tag:
V5
Notes:
No stop codon in insert

Originally Annotated References:

Gene:
ANKS1B (56899)

Vector Information:

Vector Backbone:
pLX_317
Pol II Cassette 1:
SV40-PuroR
Pol II Cassette 2:
EF1a-TRCN0000474562
Selection Marker:
PuroR
Visible Reporter:
n/a
Epitope Tag:
n/a

Current transcripts matched by this ORF:

Taxon Gene Symbol Description Transcript Nuc. Match %[?] Prot. Match %[?] Match Diffs[?]
1 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449069.1 96.4% 96.4% 1_45del;571_573delCAG
2 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449070.1 91.8% 88.5% (many diffs)
3 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352189.1 91.4% 91.4% 1_123del
4 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352193.2 91.3% 91.3% 1_45del;573_574ins72
5 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449065.1 91.2% 91.2% 1_123del;649_651delCAG
6 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352192.2 91.1% 91.1% 1_45del;573_574ins72;1178_1179insGCA
7 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352190.1 91% 91% 1_123del;649_651delCAG;1331_1332insGCA
8 human 56899 ANKS1B ankyrin repeat and sterile ... NM_181670.4 85.8% 85.8% 1_216del
9 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352198.2 85.7% 85.7% 1_216del;742_744delCAG
10 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352195.2 85.6% 85.6% 1_216del;1421_1422insGCA
11 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352205.2 85.5% 85.5% 1_216del;742_744delCAG;1424_1425insGCA
12 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352196.1 81.7% 78.9% (many diffs)
13 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352204.2 81.1% 81.1% 1_216del;744_745ins72
14 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352202.2 80.9% 80.9% 1_216del;744_745ins72;1349_1350insGCA
15 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449067.1 79% 79% 1_216del;563_564ins102;1319_1320insGCA
16 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449066.1 78.8% 78.8% (many diffs)
17 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352200.2 78.7% 78.6% (many diffs)
18 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352191.2 78.1% 78.1% 1_45del;393_394ins252
19 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352197.1 77.1% 74.3% (many diffs)
20 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204066.2 75.4% 75.4% 1_45del;284_285ins285;965_966insGCA
21 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449064.1 75.2% 75.2% 1_429del;955_957delCAG
22 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449068.1 75% 72.2% (many diffs)
23 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204068.2 74.2% 74.1% (many diffs)
24 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204069.2 74.1% 74.1% 1_216del;563_564ins180
25 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352206.2 73.9% 73.9% 1_216del;563_564ins180;1241_1242insGCA
26 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204067.1 73.6% 73.6% 1_123del;471_472ins252;1076_1077insGCA
27 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204070.2 69.4% 69.4% 1_216del;564_565ins252
28 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352199.2 69.2% 69.2% 1_216del;564_565ins252;1169_1170insGCA
29 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352203.2 67.2% 67.2% 1_216del;455_456ins285
30 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204065.2 66.2% 66.2% 0_1ins444
31 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352219.2 66% 66% 0_1ins444;82_84delCAG
32 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352208.2 65.9% 65.9% 0_1ins444;761_762insGCA
33 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352222.2 65.9% 65.9% 0_1ins444;761_762insGCA
34 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204079.2 65.8% 65.8% 0_1ins444;82_84delCAG;764_765insGCA
35 human 56899 ANKS1B ankyrin repeat and sterile ... NM_020140.3 65.4% 62.7% (many diffs)
36 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352194.2 62.3% 62.3% 1_216del;452_453ins360
37 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352201.2 62.1% 62.1% 1_216del;452_453ins360;1061_1062insGCA
38 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352223.1 61.4% 58.3% (many diffs)
39 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204080.2 60.7% 60.7% 0_1ins444;84_85ins72
40 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352207.2 60.7% 60.7% 0_1ins444;84_85ins72
41 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352209.2 60.5% 60.5% 0_1ins444;84_85ins72;689_690insGCA
42 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352221.2 60.5% 60.5% 0_1ins444;84_85ins72;689_690insGCA
43 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001204081.1 56.1% 53.1% (many diffs)
44 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352225.2 54.8% 54.3% (many diffs)
45 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352210.2 54.6% 54.1% (many diffs)
46 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449060.1 50.6% 50.6% 1_1278del;1804_1806delCAG
47 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449062.1 50.6% 50.6% 1_1278del;1804_1806delCAG
48 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449063.1 47.8% 47.8% 1_1278del;1806_1807ins72;2411_2412insGCA
49 human 56899 ANKS1B ankyrin repeat and sterile ... XM_024449061.1 47.7% 47.7% 1_1434del;1960_1962delCAG
50 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352211.2 43.6% 43.6% 0_1ins741
51 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352212.2 43.6% 43.6% 0_1ins741
52 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352218.2 43.6% 43.6% 0_1ins741
53 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352220.2 43.6% 43.6% 0_1ins741
54 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352224.2 43.6% 43.6% 0_1ins741
55 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352217.2 43.3% 43.3% 0_1ins741;464_465insGCA
56 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352213.1 39.1% 36.3% (many diffs)
57 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352214.1 39.1% 36.3% (many diffs)
58 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352216.1 39.1% 36.3% (many diffs)
59 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019652.2 34.1% 34.1% 1_2526del;3052_3054delCAG
60 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719504.4 34.1% 34.1% 1_2538del
61 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352186.1 34% 34% 1_2538del;3064_3066delCAG
62 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352188.1 34% 34% 1_2538del;3743_3744insGCA
63 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719505.4 34% 34% 1_2538del;3064_3066delCAG;3746_3747insGCA
64 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019654.2 32.6% 31.7% (many diffs)
65 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019653.2 32.5% 31.6% (many diffs)
66 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719507.4 32.5% 31.6% (many diffs)
67 human 56899 ANKS1B ankyrin repeat and sterile ... XM_005269029.5 32.3% 32.3% 1_2526del;3054_3055ins72
68 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352187.1 32.2% 32.2% 1_2538del;3066_3067ins72
69 human 56899 ANKS1B ankyrin repeat and sterile ... NM_001352185.1 32.1% 32.1% 1_2538del;3066_3067ins72;3671_3672insGCA
70 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019655.2 31.7% 31.5% (many diffs)
71 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719508.4 31.7% 31.5% (many diffs)
72 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019656.2 31.4% 31.4% 1_2538del;2885_2886ins102
73 human 56899 ANKS1B ankyrin repeat and sterile ... XM_011538571.3 31.4% 31.4% 1_2538del;2885_2886ins102;2962_2964delCAG
74 human 56899 ANKS1B ankyrin repeat and sterile ... NM_152788.4 30.7% 29.7% (many diffs)
75 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719510.4 29.9% 29.6% (many diffs)
76 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019657.2 29.5% 29.5% 1_2538del;2885_2886ins102;2964_2965ins72
77 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719512.4 27.5% 27.5% 1_2538del;2886_2887ins252
78 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719513.4 27.4% 27.4% 1_2538del;2886_2887ins252;3491_3492insGCA
79 human 56899 ANKS1B ankyrin repeat and sterile ... XM_006719514.4 26.1% 25.2% (many diffs)
80 human 56899 ANKS1B ankyrin repeat and sterile ... XM_017019658.2 26% 25.1% (many diffs)
81 human 56899 ANKS1B ankyrin repeat and sterile ... XR_001748815.2 19.9% (many diffs)
82 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314157.1 85.5% 90.7% (many diffs)
83 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001177396.1 80.5% 85.2% (many diffs)
84 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001177397.1 78.9% 83.2% (many diffs)
85 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514312.3 69.2% 74.3% (many diffs)
86 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001177398.1 69% 73.7% (many diffs)
87 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514313.3 68.8% 73.5% (many diffs)
88 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_181398.3 64.3% 68.8% (many diffs)
89 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314158.1 61.8% 65.9% (many diffs)
90 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314159.1 61.8% 65.9% (many diffs)
91 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314160.1 61.8% 65.9% (many diffs)
92 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314161.1 61.5% 65.6% (many diffs)
93 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314162.1 61.5% 65.6% (many diffs)
94 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001347053.1 56.6% 60.5% (many diffs)
95 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001347054.1 56.6% 60.5% (many diffs)
96 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314156.1 38% 40.7% (many diffs)
97 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314150.1 32.1% 34% (many diffs)
98 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314151.1 32% 33.9% (many diffs)
99 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314148.1 31.2% 33.1% (many diffs)
100 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514301.2 31.2% 33.1% (many diffs)
101 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514302.2 31.1% 33% (many diffs)
102 mouse 77531 Anks1b ankyrin repeat and sterile ... NM_001128086.2 30.3% 32.1% (many diffs)
103 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314152.1 30.2% 32% (many diffs)
104 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514303.2 29.5% 31.3% (many diffs)
105 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514304.2 29% 30.5% (many diffs)
106 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314149.1 28.8% 30.6% (many diffs)
107 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514305.3 28.8% 30.6% (many diffs)
108 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_006514306.2 27.3% 28.7% (many diffs)
109 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314153.1 24.9% 26.7% (many diffs)
110 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314154.1 24.9% 26.6% (many diffs)
111 mouse 77531 Anks1b ankyrin repeat and sterile ... XM_017314155.1 24% 25.9% (many diffs)
Download CSV

Sequence Information

Note: uppercase bases indicate empirically verified sequence.

ORF start:
66
ORF end:
1380
ORF length:
1314
Sequence:
1tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag
61ttggcatgga agatcaggat ttgttggaaa ttggaatcct taattctggg cacagacaaa
121gaattctaca ggcaatccag ctccttccaa agatgagacc cattgggcat gatggctacc
181atcccacctc tgtagctgag tggctggatt ccattgaact gggcgactac accaaagcct
241ttctaattaa tggctacact tcgatggacc tgttgaaaaa aatctgggag gttgaactta
301ttaatgtttt aaaaatcaat ttgattggcc acaggaaacg tattttggca tctctgggag
361acaggctgca cgacgatccc ccacagaagc cccctcggtc catcaccctc agggaaccca
421gtggtaatca cactcctcct cagttgtctc catcacttag ccaaagcact tacaccactg
481gtggctccct agacgttcct cacattatca tgcagggcga tgcaaggagg agaagaaatg
541aaaactactt tgatgatatt ccccgatcaa aactggagag gcagatggct cagtcgtctg
601tctgtgaaat atggacgaat cagaacgcag gatttccttt ctcagcgatc catcaggttc
661ataatacagg agactgggga gaaccttcca ttaccttgcg acctccgaat gaagccacag
721cctctacccc ggtacagtac tggcagcatc acccagaaaa gcttatcttc cagtcgtgtg
781attacaaagc tttttattta ggttctatgc tgataaaaga gcttaggggg acagaatcaa
841cccaagatgc ttgtgcaaaa atgcgggcta actgtcagaa gtctacagag caaatgaaga
901aggtccctac tattattctt tctgtctcat ataaaggagt caaatttatt gatgcaacaa
961ataagaacat aattgctgag catgaaattc gtaatatctc ctgtgctgcc caggacccag
1021aagacctctc aacatttgcc tatatcacaa aagatttgaa gtctaatcac cactactgtc
1081atgtgtttac tgcctttgat gtgaatttag cctatgaaat catcctaacc ctgggacagg
1141cattcgaagt cgcttaccag ctagcacTAC AAGCAAGAAA AGGGGGACAC TCCTCCACAC
1201TTCCAGAAAG CTTTGAAAAC AAACCCTCCA AACCCATCCC CAAGCCCCGC GTTAGCATTC
1261GCAAGTCCGT GCAGATCGAC CCATCTGAGC AAAAGACTCT GGCCAATCTA CCGTGGATTG
1321TGGAGCCGGG CCAAGAAGCC AAGAGGGGCA TTAATACCAA GTATGAAACC ACGATTTTCT
1381GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG
1441GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC
1501TTTATATATC TTGTGGAAAG GACGATCACT GTACAGTACA GTCAGCCCAA CGCGTTAAGT
1561Cgacaatcaa cctctggatt acaaaatttg tgaaagatt

Download FASTA (ORF) (Full)