Transcript: Mouse XM_006514345.3

PREDICTED: Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 (Ddx50), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ddx50 (94213)
Length:
2758
CDS:
493..2535

Additional Resources:

NCBI RefSeq record:
XM_006514345.3
NBCI Gene record:
Ddx50 (94213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104016 CGATCTTTGATAACTTCTGAT pLKO.1 2053 CDS 100% 4.950 3.960 N Ddx50 n/a
2 TRCN0000104017 GCCTTCTCTAATTTCTCCATT pLKO.1 895 CDS 100% 4.950 3.465 N Ddx50 n/a
3 TRCN0000104015 GCTTGCCTATTTCTGTCTAAT pLKO.1 2564 3UTR 100% 13.200 7.920 N Ddx50 n/a
4 TRCN0000104018 AGCGAGTGTCATCCTCAGAAA pLKO.1 815 CDS 100% 4.950 2.970 N Ddx50 n/a
5 TRCN0000104019 CCAGCCAAATTACCTGAAATT pLKO.1 2293 CDS 100% 13.200 6.600 Y Ddx50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04024 pDONR223 100% 85.4% 88.3% None (many diffs) n/a
2 ccsbBroad304_04024 pLX_304 0% 85.4% 88.3% V5 (many diffs) n/a
3 TRCN0000470566 CATCAGCTGAAGCTCCTCATATCG pLX_317 20.8% 85.4% 88.3% V5 (many diffs) n/a
Download CSV