Transcript: Mouse XM_006514564.3

PREDICTED: Mus musculus COMM domain containing 1 (Commd1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Commd1 (17846)
Length:
815
CDS:
235..606

Additional Resources:

NCBI RefSeq record:
XM_006514564.3
NBCI Gene record:
Commd1 (17846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337995 ACAGCCCTGTTGCCATAATAG pLKO_005 452 CDS 100% 13.200 9.240 N Commd1 n/a
2 TRCN0000198291 GTCTATTGCATCTGCAGACAT pLKO.1 216 5UTR 100% 4.950 3.465 N Commd1 n/a
3 TRCN0000337931 GTCTATTGCATCTGCAGACAT pLKO_005 216 5UTR 100% 4.950 3.465 N Commd1 n/a
4 TRCN0000197798 GATGAAGTTAAAGTCAAGCAA pLKO.1 526 CDS 100% 3.000 2.100 N Commd1 n/a
5 TRCN0000350952 GATGAAGTTAAAGTCAAGCAA pLKO_005 526 CDS 100% 3.000 2.100 N Commd1 n/a
6 TRCN0000337996 TAACTGAAGAGAGTATCAATA pLKO_005 604 CDS 100% 13.200 7.920 N Commd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09673 pDONR223 100% 56.9% 55.7% None (many diffs) n/a
2 ccsbBroad304_09673 pLX_304 0% 56.9% 55.7% V5 (many diffs) n/a
3 TRCN0000474347 GGGACAAACCCGGACCGAGTTCTA pLX_317 62% 56.8% 10% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV