Transcript: Mouse XM_006514956.3

PREDICTED: Mus musculus DNA methyltransferase 3A (Dnmt3a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnmt3a (13435)
Length:
10840
CDS:
1419..4145

Additional Resources:

NCBI RefSeq record:
XM_006514956.3
NBCI Gene record:
Dnmt3a (13435)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514956.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231276 CGCTCCGCTGAAGGAATATTT pLKO_005 4112 CDS 100% 15.000 21.000 N Dnmt3a n/a
2 TRCN0000039035 GCAGACCAACATCGAATCCAT pLKO.1 1868 CDS 100% 3.000 4.200 N Dnmt3a n/a
3 TRCN0000231277 CTTATGGTTCTGGCTATAATT pLKO_005 5558 3UTR 100% 15.000 12.000 N Dnmt3a n/a
4 TRCN0000231275 ACCACCAGGTCAAACTCTATA pLKO_005 3906 CDS 100% 13.200 9.240 N Dnmt3a n/a
5 TRCN0000039036 CCACCAGGTCAAACTCTATAA pLKO.1 3907 CDS 100% 13.200 9.240 N Dnmt3a n/a
6 TRCN0000039034 CCAGATGTTCTTTGCCAATAA pLKO.1 3221 CDS 100% 13.200 9.240 N Dnmt3a n/a
7 TRCN0000418113 GGCATCCACTGTGAATGATAA pLKO_005 3821 CDS 100% 13.200 9.240 N DNMT3A n/a
8 TRCN0000231274 AGAGGGACATCTCGCGATTTC pLKO_005 3703 CDS 100% 10.800 7.560 N Dnmt3a n/a
9 TRCN0000433210 AGCGTCACACAGAAGCATATC pLKO_005 3471 CDS 100% 10.800 7.560 N DNMT3A n/a
10 TRCN0000231273 CTGCTACATGTGCGGGCATAA pLKO_005 3152 CDS 100% 10.800 7.560 N Dnmt3a n/a
11 TRCN0000039038 CCCGTGATGATTGACGCCAAA pLKO.1 3735 CDS 100% 4.050 2.835 N Dnmt3a n/a
12 TRCN0000039037 CCAGAACTGTAAGAACTGCTT pLKO.1 2948 CDS 100% 2.640 1.848 N Dnmt3a n/a
13 TRCN0000035758 CCACCAGAAGAAGAGAAGAAT pLKO.1 2676 CDS 100% 5.625 3.375 N DNMT3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514956.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00454 pDONR223 100% 90.2% 95.9% None (many diffs) n/a
2 ccsbBroad304_00454 pLX_304 0% 90.2% 95.9% V5 (many diffs) n/a
3 TRCN0000473305 TCCTGATCAGAATGGATACCCTAC pLX_317 14.2% 90.2% 95.9% V5 (many diffs) n/a
Download CSV