Transcript: Mouse XM_006515134.3

PREDICTED: Mus musculus ataxin 7-like 1 (Atxn7l1), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atxn7l1 (380753)
Length:
3048
CDS:
306..2831

Additional Resources:

NCBI RefSeq record:
XM_006515134.3
NBCI Gene record:
Atxn7l1 (380753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216935 CCTTTAGTCCTCACAACAAAC pLKO.1 2875 3UTR 100% 10.800 15.120 N Atxn7l1 n/a
2 TRCN0000180160 CGACGAATCTCCAAGTAACAA pLKO.1 2132 CDS 100% 5.625 7.875 N Atxn7l1 n/a
3 TRCN0000178764 CGAGGATACTATGTGTTTGAT pLKO.1 1344 CDS 100% 5.625 7.875 N Atxn7l1 n/a
4 TRCN0000348871 TTCACCAGAGAAGATCTTAAA pLKO_005 680 CDS 100% 13.200 10.560 N Atxn7l1 n/a
5 TRCN0000376062 ATCGTCTGCAAACAGCATAAG pLKO_005 1124 CDS 100% 10.800 8.640 N Atxn7l1 n/a
6 TRCN0000376123 AGCACCTCAAAGCCATTTAAA pLKO_005 411 CDS 100% 15.000 10.500 N Atxn7l1 n/a
7 TRCN0000217153 CTTCACCAGAGAAGATCTTAA pLKO.1 679 CDS 100% 13.200 9.240 N Atxn7l1 n/a
8 TRCN0000348932 TGCTGAGCACTTTACAGTAAT pLKO_005 2849 3UTR 100% 13.200 9.240 N Atxn7l1 n/a
9 TRCN0000363855 ATAGAAGGTGGGATCGATTTC pLKO_005 1363 CDS 100% 10.800 7.560 N Atxn7l1 n/a
10 TRCN0000217719 GATAGAAGGTGGGATCGATTT pLKO.1 1362 CDS 100% 10.800 7.560 N Atxn7l1 n/a
11 TRCN0000180185 CGAGAAGTTAGACTGTCAGTT pLKO.1 1265 CDS 100% 4.950 3.465 N Atxn7l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13436 pDONR223 100% 58% 57.6% None (many diffs) n/a
2 ccsbBroad304_13436 pLX_304 0% 58% 57.6% V5 (many diffs) n/a
3 TRCN0000474251 TGACTGAAATGCCAATCCTTACAA pLX_317 30.6% 58% 57.6% V5 (many diffs) n/a
Download CSV