Transcript: Mouse XM_006515136.2

PREDICTED: Mus musculus ataxin 7-like 1 (Atxn7l1), transcript variant X14, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atxn7l1 (380753)
Length:
2690
CDS:
224..2473

Additional Resources:

NCBI RefSeq record:
XM_006515136.2
NBCI Gene record:
Atxn7l1 (380753)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515136.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216935 CCTTTAGTCCTCACAACAAAC pLKO.1 2517 3UTR 100% 10.800 15.120 N Atxn7l1 n/a
2 TRCN0000180160 CGACGAATCTCCAAGTAACAA pLKO.1 1774 CDS 100% 5.625 7.875 N Atxn7l1 n/a
3 TRCN0000178764 CGAGGATACTATGTGTTTGAT pLKO.1 986 CDS 100% 5.625 7.875 N Atxn7l1 n/a
4 TRCN0000348871 TTCACCAGAGAAGATCTTAAA pLKO_005 322 CDS 100% 13.200 10.560 N Atxn7l1 n/a
5 TRCN0000376062 ATCGTCTGCAAACAGCATAAG pLKO_005 766 CDS 100% 10.800 8.640 N Atxn7l1 n/a
6 TRCN0000217153 CTTCACCAGAGAAGATCTTAA pLKO.1 321 CDS 100% 13.200 9.240 N Atxn7l1 n/a
7 TRCN0000348932 TGCTGAGCACTTTACAGTAAT pLKO_005 2491 3UTR 100% 13.200 9.240 N Atxn7l1 n/a
8 TRCN0000363855 ATAGAAGGTGGGATCGATTTC pLKO_005 1005 CDS 100% 10.800 7.560 N Atxn7l1 n/a
9 TRCN0000217719 GATAGAAGGTGGGATCGATTT pLKO.1 1004 CDS 100% 10.800 7.560 N Atxn7l1 n/a
10 TRCN0000180185 CGAGAAGTTAGACTGTCAGTT pLKO.1 907 CDS 100% 4.950 3.465 N Atxn7l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515136.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13436 pDONR223 100% 65.1% 64.7% None (many diffs) n/a
2 ccsbBroad304_13436 pLX_304 0% 65.1% 64.7% V5 (many diffs) n/a
3 TRCN0000474251 TGACTGAAATGCCAATCCTTACAA pLX_317 30.6% 65.1% 64.7% V5 (many diffs) n/a
Download CSV