Transcript: Mouse XM_006515228.3

PREDICTED: Mus musculus high mobility group box transcription factor 1 (Hbp1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hbp1 (73389)
Length:
3732
CDS:
72..1754

Additional Resources:

NCBI RefSeq record:
XM_006515228.3
NBCI Gene record:
Hbp1 (73389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304498 CTATGGGTCTGATGGTCTAAA pLKO_005 839 CDS 100% 13.200 10.560 N Hbp1 n/a
2 TRCN0000015276 CTGATGGTCTAAAGTTGTTAT pLKO.1 847 CDS 100% 13.200 10.560 N HBP1 n/a
3 TRCN0000084633 GCTACAATCATGGCTTCTCAT pLKO.1 3579 3UTR 100% 4.950 3.960 N Hbp1 n/a
4 TRCN0000301767 GCTACAATCATGGCTTCTCAT pLKO_005 3579 3UTR 100% 4.950 3.960 N Hbp1 n/a
5 TRCN0000015277 GAGTGCCACTTCTCCTAATAA pLKO.1 1355 CDS 100% 15.000 10.500 N HBP1 n/a
6 TRCN0000084637 CAGAGTTGAATATACTCAGAT pLKO.1 1421 CDS 100% 4.950 3.465 N Hbp1 n/a
7 TRCN0000331755 CAGAGTTGAATATACTCAGAT pLKO_005 1421 CDS 100% 4.950 3.465 N Hbp1 n/a
8 TRCN0000084635 CCAGGATACAACTCCTGTGAT pLKO.1 204 CDS 100% 0.495 0.347 N Hbp1 n/a
9 TRCN0000084634 CCCTACCCAATCTGCCATATA pLKO.1 275 CDS 100% 13.200 7.920 N Hbp1 n/a
10 TRCN0000301760 CCCTACCCAATCTGCCATATA pLKO_005 275 CDS 100% 13.200 7.920 N Hbp1 n/a
11 TRCN0000084636 GCTTCCATAAGGAAAGCAATA pLKO.1 736 CDS 100% 10.800 6.480 N Hbp1 n/a
12 TRCN0000301827 GCTTCCATAAGGAAAGCAATA pLKO_005 736 CDS 100% 10.800 6.480 N Hbp1 n/a
13 TRCN0000015275 GCAAAGGCTTTGGCTGAAGAA pLKO.1 1536 CDS 100% 4.950 2.970 N HBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08038 pDONR223 100% 84.4% 82.1% None (many diffs) n/a
2 ccsbBroad304_08038 pLX_304 0% 84.4% 82.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473971 TTACTTCAGTTAATACATAATTTT pLX_317 34.9% 84.4% 82.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV