Transcript: Mouse XM_006515471.1

PREDICTED: Mus musculus Ena-vasodilator stimulated phosphoprotein (Evl), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Evl (14026)
Length:
1860
CDS:
160..1410

Additional Resources:

NCBI RefSeq record:
XM_006515471.1
NBCI Gene record:
Evl (14026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091074 CCGTCAGGTCTATGGCTTAAA pLKO.1 417 CDS 100% 13.200 18.480 N Evl n/a
2 TRCN0000063870 CCGGATCAACATCTACCACAA pLKO.1 267 CDS 100% 4.050 5.670 N EVL n/a
3 TRCN0000091076 GCCCGTCAGGTCTATGGCTTA pLKO.1 415 CDS 100% 1.350 1.890 N Evl n/a
4 TRCN0000091075 CCTCATGGAAGAAATGAACAA pLKO.1 957 CDS 100% 4.950 3.465 N Evl n/a
5 TRCN0000091073 GCTTTATTAGATGGCTTCCAA pLKO.1 1658 3UTR 100% 3.000 2.100 N Evl n/a
6 TRCN0000091077 GACACCAGTAAGAAGTGGGTA pLKO.1 217 CDS 100% 2.640 1.848 N Evl n/a
7 TRCN0000294336 ACGATGACACCAGTAAGAAAT pLKO_005 212 CDS 100% 13.200 9.240 N EVL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03311 pDONR223 100% 89.1% 93.3% None (many diffs) n/a
2 ccsbBroad304_03311 pLX_304 0% 89.1% 93.3% V5 (many diffs) n/a
3 ccsbBroadEn_10459 pDONR223 100% 88.9% 93% None (many diffs) n/a
4 ccsbBroad304_10459 pLX_304 0% 88.9% 93% V5 (many diffs) n/a
5 TRCN0000471524 TTTACTACCAGAGTAGATCTTTTT pLX_317 17.9% 88.9% 93% V5 (many diffs) n/a
Download CSV