Transcript: Mouse XM_006515478.3

PREDICTED: Mus musculus hypoxia inducible factor 1, alpha subunit (Hif1a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hif1a (15251)
Length:
3947
CDS:
287..2758

Additional Resources:

NCBI RefSeq record:
XM_006515478.3
NBCI Gene record:
Hif1a (15251)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232223 TATGCACTTTGTCGCTATTAA pLKO_005 3730 3UTR 100% 15.000 21.000 N Hif1a n/a
2 TRCN0000232220 CCCATTCCTCATCCGTCAAAT pLKO_005 965 CDS 100% 13.200 18.480 N Hif1a n/a
3 TRCN0000232221 AGTCGACACAGCCTCGATATG pLKO_005 1019 CDS 100% 10.800 15.120 N Hif1a n/a
4 TRCN0000232222 TGGATAGCGATATGGTCAATG pLKO_005 1854 CDS 100% 10.800 15.120 N Hif1a n/a
5 TRCN0000054450 CCAGTTACGATTGTGAAGTTA pLKO.1 2664 CDS 100% 5.625 7.875 N Hif1a n/a
6 TRCN0000054449 GCCGCTCAATTTATGAATATT pLKO.1 1104 CDS 100% 15.000 10.500 N Hif1a n/a
7 TRCN0000232219 CTTCACTGCACGGGCCATATT pLKO_005 863 CDS 100% 13.200 9.240 N Hif1a n/a
8 TRCN0000054448 GCCACTTTGAATCAAAGAAAT pLKO.1 2354 CDS 100% 13.200 9.240 N Hif1a n/a
9 TRCN0000054451 CCCAGTGAATATTGCTTTGAT pLKO.1 1832 CDS 100% 5.625 3.938 N Hif1a n/a
10 TRCN0000054452 CCAAAGTTGAATCAGAGGATA pLKO.1 1416 CDS 100% 4.950 2.970 N Hif1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491723 GGGCCCGCTGCGCCATCCCGCCTT pLX_317 9.5% 88.6% 90.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489130 GCCTAGCCTAATGAGAGCAGCGAT pLX_317 9.3% 88.6% 90.2% V5 (many diffs) n/a
3 ccsbBroadEn_06365 pDONR223 100% 88.6% 90.3% None (many diffs) n/a
4 ccsbBroad304_06365 pLX_304 14% 88.6% 90.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000475140 CCCACAATGCGGTACGTGCAGGGA pLX_317 14.8% 88.6% 90.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV