Transcript: Mouse XM_006515587.1

PREDICTED: Mus musculus protein kinase D1 (Prkd1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prkd1 (18760)
Length:
3784
CDS:
276..3008

Additional Resources:

NCBI RefSeq record:
XM_006515587.1
NBCI Gene record:
Prkd1 (18760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361435 GAATTGGAGAACGCTATATTA pLKO_005 2830 CDS 100% 15.000 21.000 N Prkd1 n/a
2 TRCN0000361372 TGGTGCGTCAAGGCCTTAAAT pLKO_005 778 CDS 100% 15.000 21.000 N Prkd1 n/a
3 TRCN0000195157 CTATCAGACCTGGTTAGATTT pLKO.1 2792 CDS 100% 13.200 18.480 N PRKD1 n/a
4 TRCN0000195251 CAGGAAGAGATGTAGCTATTA pLKO.1 2083 CDS 100% 13.200 9.240 N PRKD1 n/a
5 TRCN0000368784 CTTCGTAATGAGGTTGCAATT pLKO_005 2148 CDS 100% 10.800 7.560 N Prkd1 n/a
6 TRCN0000220677 CCCTTCAACGAGCAACAACAT pLKO.1 1460 CDS 100% 4.950 3.465 N Prkd1 n/a
7 TRCN0000220678 GAGTGTTTGTTGTTATGGAAA pLKO.1 2230 CDS 100% 4.950 3.465 N Prkd1 n/a
8 TRCN0000220676 GCAGTGGAGTTAGAAGGAGAA pLKO.1 856 CDS 100% 4.050 2.835 N Prkd1 n/a
9 TRCN0000220679 CCTTCAGCTTTAACTCCCGTT pLKO.1 1704 CDS 100% 2.160 1.296 N Prkd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14794 pDONR223 53% 87.6% 21.8% None (many diffs) n/a
2 ccsbBroad304_14794 pLX_304 0% 87.6% 21.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473066 AGCCCACTGGCGACGGCTTTAACC pLX_317 15.1% 87.6% 21.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV