Transcript: Mouse XM_006515632.3

PREDICTED: Mus musculus sine oculis-related homeobox 4 (Six4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Six4 (20474)
Length:
7541
CDS:
1405..3708

Additional Resources:

NCBI RefSeq record:
XM_006515632.3
NBCI Gene record:
Six4 (20474)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515632.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339136 AGACTATCATAAGGGTATATT pLKO_005 4174 3UTR 100% 15.000 21.000 N Six4 n/a
2 TRCN0000339074 GCCACGTGGAGCCAGTATATA pLKO_005 2336 CDS 100% 15.000 21.000 N Six4 n/a
3 TRCN0000420112 GCCAGTATATATGCAACAAAT pLKO_005 2346 CDS 100% 13.200 18.480 N SIX4 n/a
4 TRCN0000339073 TAATGATGTTAGACTCGAAAT pLKO_005 3572 CDS 100% 10.800 15.120 N Six4 n/a
5 TRCN0000339072 TTACTACACCCGTGCAAATTA pLKO_005 2777 CDS 100% 15.000 12.000 N Six4 n/a
6 TRCN0000351074 ACACAATGGAGTTATCCTTAA pLKO_005 2475 CDS 100% 10.800 8.640 N Six4 n/a
7 TRCN0000070796 GCAGCTTCACAAGGTAATCTT pLKO.1 2899 CDS 100% 5.625 4.500 N Six4 n/a
8 TRCN0000070793 CCCGTGCAAATTAACCAGTAT pLKO.1 2785 CDS 100% 4.950 3.960 N Six4 n/a
9 TRCN0000070794 CCTCCCAGGATGTGAAAGAAT pLKO.1 2600 CDS 100% 5.625 3.938 N Six4 n/a
10 TRCN0000070797 GATGAAGACATGCAAGACTTA pLKO.1 3685 CDS 100% 4.950 3.465 N Six4 n/a
11 TRCN0000070795 CCTGTCTTCCTTAATGGCAAT pLKO.1 2440 CDS 100% 4.050 2.835 N Six4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515632.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15076 pDONR223 96.5% 87.5% 88.7% None (many diffs) n/a
2 ccsbBroad304_15076 pLX_304 0% 87.5% 88.7% V5 (many diffs) n/a
3 TRCN0000479146 GTGACTGGTTATGTCGCCGGACAT pLX_317 19.8% 87.5% 88.7% V5 (many diffs) n/a
Download CSV