Transcript: Mouse XM_006515796.3

PREDICTED: Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 13B (Ppp1r13b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r13b (21981)
Length:
4488
CDS:
236..3604

Additional Resources:

NCBI RefSeq record:
XM_006515796.3
NBCI Gene record:
Ppp1r13b (21981)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088300 CCTGTCGAGATGTCGTAGAAT pLKO.1 315 CDS 100% 5.625 7.875 N Ppp1r13b n/a
2 TRCN0000088299 GCACCTTAAATAAGTCAGTTA pLKO.1 2130 CDS 100% 4.950 3.960 N Ppp1r13b n/a
3 TRCN0000088302 CCACCACCATATCGTGAAGTT pLKO.1 3127 CDS 100% 4.950 3.465 N Ppp1r13b n/a
4 TRCN0000088298 CCCTTCTTGGAAAGCCTCAAA pLKO.1 3976 3UTR 100% 4.950 3.465 N Ppp1r13b n/a
5 TRCN0000088301 CCAGTCATACAATGGCAGGTT pLKO.1 994 CDS 100% 2.640 1.848 N Ppp1r13b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02755 pDONR223 100% 83.3% 88.8% None (many diffs) n/a
2 ccsbBroad304_02755 pLX_304 0% 83.3% 88.8% V5 (many diffs) n/a
3 TRCN0000477224 ACTGCCACTGATAAACTACCGCGT pLX_317 14% 83.3% 88.8% V5 (many diffs) n/a
4 ccsbBroadEn_14081 pDONR223 100% 83.2% 41.6% None (many diffs) n/a
5 ccsbBroad304_14081 pLX_304 0% 83.2% 41.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000467453 GTTTATTAAAGCCAACTTGATCGC pLX_317 10.1% 83.2% 41.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV