Transcript: Mouse XM_006515831.3

PREDICTED: Mus musculus leucine rich repeat and fibronectin type III domain containing 5 (Lrfn5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrfn5 (238205)
Length:
5916
CDS:
2411..4651

Additional Resources:

NCBI RefSeq record:
XM_006515831.3
NBCI Gene record:
Lrfn5 (238205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248426 ACGAAGGTTAGCAACGTTTAT pLKO_005 4100 CDS 100% 13.200 18.480 N Lrfn5 n/a
2 TRCN0000248428 CATACTAATGATCCGGTATAA pLKO_005 4048 CDS 100% 13.200 18.480 N Lrfn5 n/a
3 TRCN0000175134 CGGAATCCGTATGTTTCAAAT pLKO.1 3736 CDS 100% 13.200 18.480 N Lrfn5 n/a
4 TRCN0000424763 TTACTACGGAACAGGATTATG pLKO_005 3933 CDS 100% 13.200 18.480 N LRFN5 n/a
5 TRCN0000174388 CCACCATTTGATATTGAACAA pLKO.1 2785 CDS 100% 4.950 6.930 N Lrfn5 n/a
6 TRCN0000216009 CAATTGAAGGCACGATATTAT pLKO.1 5234 3UTR 100% 15.000 12.000 N Lrfn5 n/a
7 TRCN0000248429 AGCGATTTCTCAGCCTATAAA pLKO_005 4999 3UTR 100% 15.000 10.500 N Lrfn5 n/a
8 TRCN0000248427 TCGAATGCTAGCAGTAGTAAT pLKO_005 3623 CDS 100% 13.200 9.240 N Lrfn5 n/a
9 TRCN0000248425 TTCGTCAACAGCATTACTAAA pLKO_005 3691 CDS 100% 13.200 9.240 N Lrfn5 n/a
10 TRCN0000174500 CAACATTCCTAAGGGTACTTT pLKO.1 2962 CDS 100% 5.625 3.938 N Lrfn5 n/a
11 TRCN0000110170 CGTGTGTGTATGCGTGTGTTT pLKO.1 986 5UTR 100% 4.950 2.475 Y Rgl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489935 GCTCGGGTGGTGGACCCCCTTGGT pLX_317 24.1% 87.3% 91.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV