Transcript: Mouse XM_006515913.1

PREDICTED: Mus musculus transmembrane protein 229B (Tmem229b), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem229b (268567)
Length:
3907
CDS:
547..1050

Additional Resources:

NCBI RefSeq record:
XM_006515913.1
NBCI Gene record:
Tmem229b (268567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264878 AGTTACGTGGAAATCTATTTA pLKO_005 3590 3UTR 100% 15.000 21.000 N Tmem229b n/a
2 TRCN0000139723 CTACTTCTGCGAGGTGATGTT pLKO.1 606 CDS 100% 4.950 6.930 N TMEM229B n/a
3 TRCN0000196210 GCTGTCTCGTTGGTACCTATA pLKO.1 573 CDS 100% 0.000 0.000 N Tmem229b n/a
4 TRCN0000264877 TTTCCTCAAAGCTCTATTAAT pLKO_005 3025 3UTR 100% 15.000 10.500 N Tmem229b n/a
5 TRCN0000264876 GATCTCACGGAGTGTAGTTTA pLKO_005 3211 3UTR 100% 13.200 9.240 N Tmem229b n/a
6 TRCN0000283207 CCAAGGGAAGCTACACCTTAA pLKO_005 3164 3UTR 100% 10.800 7.560 N Tmem229b n/a
7 TRCN0000425787 GGTGCTTGCTTGCAACCAATA pLKO_005 1483 3UTR 100% 10.800 7.560 N TMEM229B n/a
8 TRCN0000264875 GTAGGAGTTTCAGATAGTAAG pLKO_005 3379 3UTR 100% 10.800 7.560 N Tmem229b n/a
9 TRCN0000183735 CCAGTTCGACTTTGATTTCAT pLKO.1 864 CDS 100% 5.625 3.938 N Tmem229b n/a
10 TRCN0000180256 CGGACATTGATGGATGACTTT pLKO.1 1307 3UTR 100% 4.950 3.465 N Tmem229b n/a
11 TRCN0000413431 GACTACTCCCAGTTCGACTTT pLKO_005 856 CDS 100% 4.950 3.465 N TMEM229B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09735 pDONR223 100% 90.2% 95.8% None (many diffs) n/a
2 ccsbBroad304_09735 pLX_304 0% 90.2% 95.8% V5 (many diffs) n/a
3 TRCN0000479943 AACCATTGGACCTGATCTCATGTT pLX_317 60.8% 90.2% 95.8% V5 (many diffs) n/a
Download CSV