Transcript: Mouse XM_006516010.2

PREDICTED: Mus musculus HEAT repeat containing 5A (Heatr5a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Heatr5a (320487)
Length:
7873
CDS:
286..6432

Additional Resources:

NCBI RefSeq record:
XM_006516010.2
NBCI Gene record:
Heatr5a (320487)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249613 ATGTACTACACCGAGTAATTT pLKO_005 5138 CDS 100% 15.000 21.000 N Heatr5a n/a
2 TRCN0000257937 CTCAACTTAGCTTCGACAAAT pLKO_005 2972 CDS 100% 13.200 18.480 N Heatr5a n/a
3 TRCN0000216526 GAGACTTTATGAACTACTAAT pLKO.1 2310 CDS 100% 13.200 18.480 N Heatr5a n/a
4 TRCN0000182983 CGTATCAAACTGTGTTGCATT pLKO.1 6816 3UTR 100% 4.950 6.930 N Heatr5a n/a
5 TRCN0000217778 CCGGATGACCTCTTGATATTA pLKO.1 2455 CDS 100% 15.000 10.500 N Heatr5a n/a
6 TRCN0000249612 TTACCTCCTGAGACCTATAAA pLKO_005 2335 CDS 100% 15.000 10.500 N Heatr5a n/a
7 TRCN0000249611 TTTGGCTGTTTACGATCATTT pLKO_005 7590 3UTR 100% 13.200 9.240 N Heatr5a n/a
8 TRCN0000180151 CGTGCGGATATCAGTTTCAAA pLKO.1 984 CDS 100% 5.625 3.938 N Heatr5a n/a
9 TRCN0000180897 GCAGACTCTGAAAGGAATCTT pLKO.1 5646 CDS 100% 5.625 3.938 N Heatr5a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11785 pDONR223 100% 4.7% 4.9% None (many diffs) n/a
2 ccsbBroad304_11785 pLX_304 0% 4.7% 4.9% V5 (many diffs) n/a
Download CSV