Transcript: Mouse XM_006516036.3

PREDICTED: Mus musculus mitogen-activated protein kinase kinase kinase 9 (Map3k9), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map3k9 (338372)
Length:
10936
CDS:
552..3854

Additional Resources:

NCBI RefSeq record:
XM_006516036.3
NBCI Gene record:
Map3k9 (338372)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516036.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022556 TGGGAAAGTTTATCGTGCTTT pLKO.1 995 CDS 100% 4.950 6.930 N Map3k9 n/a
2 TRCN0000362389 CTGGACCAGCTAACGACTATA pLKO_005 1728 CDS 100% 13.200 10.560 N Map3k9 n/a
3 TRCN0000022555 GCGAGAGCTCAATATCATCAT pLKO.1 1973 CDS 100% 4.950 3.960 N Map3k9 n/a
4 TRCN0000022557 GAACAGAGTATTGTCTGGGAA pLKO.1 1214 CDS 100% 2.640 2.112 N Map3k9 n/a
5 TRCN0000362306 TCGCCAGAGGGATGAACTATC pLKO_005 1276 CDS 100% 10.800 7.560 N Map3k9 n/a
6 TRCN0000022554 CCTGAGTAACAAGATTCTGAA pLKO.1 1382 CDS 100% 4.950 3.465 N Map3k9 n/a
7 TRCN0000022558 CCCATCTTTCACGAGTATCCT pLKO.1 1709 CDS 100% 3.000 2.100 N Map3k9 n/a
8 TRCN0000362465 ACCTTAAGTCCAGCAACATAT pLKO_005 1333 CDS 100% 13.200 7.920 N Map3k9 n/a
9 TRCN0000362307 ACGGTGTGGCCATGAACAAAC pLKO_005 1606 CDS 100% 10.800 6.480 N Map3k9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516036.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10970 pDONR223 100% 89.5% 94.7% None (many diffs) n/a
2 ccsbBroad304_10970 pLX_304 0% 89.5% 94.7% V5 (many diffs) n/a
3 TRCN0000466870 TTCTAAGGTTTTCCACCGATTGAC pLX_317 10.3% 89.5% 94.7% V5 (many diffs) n/a
4 TRCN0000491286 CGCCGTCACCATTGCTGTGGGGGC pLX_317 11.5% 86% 94.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV