Transcript: Mouse XM_006516206.3

PREDICTED: Mus musculus WD repeat domain 20 (Wdr20), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr20 (69641)
Length:
2506
CDS:
302..1633

Additional Resources:

NCBI RefSeq record:
XM_006516206.3
NBCI Gene record:
Wdr20 (69641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297624 CACGAGGAACCCTCTCCTTAA pLKO_005 502 CDS 100% 10.800 15.120 N Wdr20 n/a
2 TRCN0000279180 AGTGGGAACATGTACTTATAT pLKO_005 389 CDS 100% 15.000 10.500 N Wdr20 n/a
3 TRCN0000279179 CTCAAGAGCAAGGACACATAC pLKO_005 1060 CDS 100% 10.800 6.480 N Wdr20 n/a
4 TRCN0000216627 GATAAACTGAACCTAGTTACT pLKO.1 1355 CDS 100% 4.950 2.970 N Wdr20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09322 pDONR223 100% 67.2% 70% None (many diffs) n/a
2 ccsbBroad304_09322 pLX_304 0% 67.2% 70% V5 (many diffs) n/a
3 TRCN0000471560 TTCCTTGAGCATGCGAAAGCAATC pLX_317 25.1% 67.2% 70% V5 (many diffs) n/a
Download CSV