Transcript: Mouse XM_006516224.3

PREDICTED: Mus musculus inverted formin, FH2 and WH2 domain containing (Inf2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Inf2 (70435)
Length:
4583
CDS:
161..3949

Additional Resources:

NCBI RefSeq record:
XM_006516224.3
NBCI Gene record:
Inf2 (70435)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120503 CCTCGAGTTCTCTAGCAATAA pLKO.1 3568 CDS 100% 0.000 0.000 N Inf2 n/a
2 TRCN0000120502 GCTATGGCTGAGTTGAGGTTA pLKO.1 4317 3UTR 100% 4.950 3.960 N Inf2 n/a
3 TRCN0000120505 CATCTTCCTGAAGCAATTTAA pLKO.1 2179 CDS 100% 15.000 10.500 N Inf2 n/a
4 TRCN0000120506 GCCAACCTGAAGAAGCTTCTA pLKO.1 2777 CDS 100% 4.950 3.465 N Inf2 n/a
5 TRCN0000120504 TCCTGGTATGTGGATGCCATT pLKO.1 3458 CDS 100% 4.050 2.835 N Inf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08855 pDONR223 100% 16.2% 17.2% None (many diffs) n/a
2 ccsbBroad304_08855 pLX_304 0% 16.2% 17.2% V5 (many diffs) n/a
Download CSV