Transcript: Mouse XM_006516320.2

PREDICTED: Mus musculus tudor domain containing 9 (Tdrd9), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tdrd9 (74691)
Length:
4593
CDS:
155..4027

Additional Resources:

NCBI RefSeq record:
XM_006516320.2
NBCI Gene record:
Tdrd9 (74691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252793 TTGCCTATAAATCGGTGTAAA pLKO_005 554 CDS 100% 13.200 18.480 N Tdrd9 n/a
2 TRCN0000252794 AGCTCAGAAATGGAGTATATT pLKO_005 392 CDS 100% 15.000 10.500 N Tdrd9 n/a
3 TRCN0000252792 GTATGAGGGTAAATCTAAATA pLKO_005 4233 3UTR 100% 15.000 10.500 N Tdrd9 n/a
4 TRCN0000267585 GGCCTTTGATGTGCGCTTAAA pLKO_005 3694 CDS 100% 13.200 9.240 N Tdrd9 n/a
5 TRCN0000252791 GGTCACCATTGGCTAAGTTAA pLKO_005 489 CDS 100% 13.200 9.240 N Tdrd9 n/a
6 TRCN0000050694 CCCTATGGATTTCTTTACTAT pLKO.1 2225 CDS 100% 5.625 3.938 N TDRD9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13087 pDONR223 100% 47% 49.4% None (many diffs) n/a
2 ccsbBroad304_13087 pLX_304 0% 47% 49.4% V5 (many diffs) n/a
3 TRCN0000472461 TCTCCCTTACTTGTGAGGATAAAA pLX_317 15.1% 47% 49.4% V5 (many diffs) n/a
Download CSV