Transcript: Mouse XM_006516473.1

PREDICTED: Mus musculus disco interacting protein 2 homolog C (Dip2c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dip2c (208440)
Length:
8228
CDS:
480..5330

Additional Resources:

NCBI RefSeq record:
XM_006516473.1
NBCI Gene record:
Dip2c (208440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249875 ATTGAGTATAAGACGTGTAAA pLKO_005 2136 CDS 100% 13.200 18.480 N Dip2c n/a
2 TRCN0000257961 CAGAAGGTCTGCCAGTATAAA pLKO_005 2382 CDS 100% 15.000 10.500 N Dip2c n/a
3 TRCN0000249876 TGAATGTTAGCAGCGTTATTT pLKO_005 8019 3UTR 100% 15.000 10.500 N Dip2c n/a
4 TRCN0000249874 AGCAAATCCCTGGTCTATTTC pLKO_005 2513 CDS 100% 13.200 9.240 N Dip2c n/a
5 TRCN0000249873 CAGCTTGTCAATACCCTTAAA pLKO_005 1425 CDS 100% 13.200 9.240 N Dip2c n/a
6 TRCN0000129743 CGTGGATAGTATCACAACAAA pLKO.1 6187 3UTR 100% 5.625 3.938 N DIP2C n/a
7 TRCN0000130718 GCGTGGATAGTATCACAACAA pLKO.1 6186 3UTR 100% 4.950 3.465 N DIP2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491860 TCACAAACTTACCCTGTAGTGGTG pLX_317 7.4% 83.9% 95.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489852 GGCGACATTTAAACTATAATCTTA pLX_317 8.9% 83.9% 95.4% V5 (many diffs) n/a
Download CSV