Transcript: Mouse XM_006516476.2

PREDICTED: Mus musculus La ribonucleoprotein domain family, member 4B (Larp4b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Larp4b (217980)
Length:
5751
CDS:
62..2287

Additional Resources:

NCBI RefSeq record:
XM_006516476.2
NBCI Gene record:
Larp4b (217980)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516476.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215844 CAACAGGTAACTCTAGCTTTA pLKO.1 2832 3UTR 100% 10.800 15.120 N Larp4b n/a
2 TRCN0000144706 GATTTGTCAGAGAACGAGTAA pLKO.1 2023 CDS 100% 4.950 6.930 N LARP4B n/a
3 TRCN0000216171 CATCTGATGAATGGTCCTATA pLKO.1 137 CDS 100% 10.800 8.640 N Larp4b n/a
4 TRCN0000183471 GTTTCAGAGCTAAACCCTAAT pLKO.1 218 CDS 100% 10.800 8.640 N Larp4b n/a
5 TRCN0000292802 GTTTCAGAGCTAAACCCTAAT pLKO_005 218 CDS 100% 10.800 8.640 N Larp4b n/a
6 TRCN0000195821 CCAAATCAGAACCGGTGCATA pLKO.1 758 CDS 100% 4.950 3.960 N Larp4b n/a
7 TRCN0000180121 CAGCAGGCTTACAAATACCTT pLKO.1 923 CDS 100% 3.000 2.400 N Larp4b n/a
8 TRCN0000292864 CAGCAGGCTTACAAATACCTT pLKO_005 923 CDS 100% 3.000 2.400 N Larp4b n/a
9 TRCN0000180569 GAACGAGTAAAGACCCTTCTT pLKO.1 2034 CDS 100% 4.950 3.465 N Larp4b n/a
10 TRCN0000292863 GAACGAGTAAAGACCCTTCTT pLKO_005 2034 CDS 100% 4.950 3.465 N Larp4b n/a
11 TRCN0000183323 GATGTGGATTTGATTGTTGAA pLKO.1 683 CDS 100% 4.950 3.465 N Larp4b n/a
12 TRCN0000298062 GATGTGGATTTGATTGTTGAA pLKO_005 683 CDS 100% 4.950 3.465 N Larp4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516476.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02731 pDONR223 100% 86.7% 87.7% None (many diffs) n/a
2 ccsbBroad304_02731 pLX_304 0% 86.7% 87.7% V5 (many diffs) n/a
3 TRCN0000473978 GACTACGACTAAGTGGCATACCGC pLX_317 15.6% 86.7% 87.7% V5 (many diffs) n/a
Download CSV