Transcript: Mouse XM_006516528.2

PREDICTED: Mus musculus solute carrier family 35, member B3 (Slc35b3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc35b3 (108652)
Length:
1892
CDS:
229..1431

Additional Resources:

NCBI RefSeq record:
XM_006516528.2
NBCI Gene record:
Slc35b3 (108652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516528.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069310 CCTGTTCTTTGCTAAGCCGTT pLKO.1 1251 CDS 100% 2.160 3.024 N Slc35b3 n/a
2 TRCN0000069311 CCATCGGTGTACAACATGATA pLKO.1 1360 CDS 100% 5.625 4.500 N Slc35b3 n/a
3 TRCN0000069312 GCACAATTGCACCAAACTTTA pLKO.1 878 CDS 100% 13.200 9.240 N Slc35b3 n/a
4 TRCN0000069309 CCTGTTATGCTAGGAGGAGTT pLKO.1 769 CDS 100% 4.050 2.835 N Slc35b3 n/a
5 TRCN0000069308 CCTAGCAATGTTCTGAACATT pLKO.1 1671 3UTR 100% 0.563 0.394 N Slc35b3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516528.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08193 pDONR223 100% 73.8% 77.5% None (many diffs) n/a
2 ccsbBroad304_08193 pLX_304 0% 73.8% 77.5% V5 (many diffs) n/a
3 TRCN0000472317 GCTCAGACAAGGTAGCATAACGTT pLX_317 39.9% 73.8% 77.5% V5 (many diffs) n/a
Download CSV