Transcript: Mouse XM_006516766.4

PREDICTED: Mus musculus cyclin-dependent kinase 13 (Cdk13), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cdk13 (69562)
Length:
11530
CDS:
562..5145

Additional Resources:

NCBI RefSeq record:
XM_006516766.4
NBCI Gene record:
Cdk13 (69562)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516766.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360645 TAGAGCTAATAAGCCGTATAT pLKO_005 3329 CDS 100% 13.200 18.480 N Cdk13 n/a
2 TRCN0000022984 CCTGGATTATTGTCATAAGAA pLKO.1 3033 CDS 100% 5.625 7.875 N Cdk13 n/a
3 TRCN0000022985 CCCATATACTAACAAGGTCAT pLKO.1 3165 CDS 100% 4.050 5.670 N Cdk13 n/a
4 TRCN0000022987 GCCGTTAAACCACAGTGAATT pLKO.1 3864 CDS 100% 0.000 0.000 N Cdk13 n/a
5 TRCN0000360724 CCGAAGCAGAAGCCCATATTC pLKO_005 1791 CDS 100% 13.200 10.560 N Cdk13 n/a
6 TRCN0000368694 TTTGGACTTGCTCGTTTATAT pLKO_005 3127 CDS 100% 15.000 10.500 N Cdk13 n/a
7 TRCN0000360722 CTTGGGAGAAGAACGATATAC pLKO_005 3216 CDS 100% 13.200 9.240 N Cdk13 n/a
8 TRCN0000022988 GCCAGTTCAGTAGCTGGATAT pLKO.1 4807 CDS 100% 10.800 7.560 N Cdk13 n/a
9 TRCN0000022986 CCAGAGTATCATCAATATGAA pLKO.1 2844 CDS 100% 5.625 3.938 N Cdk13 n/a
10 TRCN0000000700 AGTGTTATTGTGAAAGGTGTA pLKO.1 5660 3UTR 100% 4.050 2.430 N CDK13 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6579 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516766.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11288 pDONR223 100% 19.6% 20.1% None (many diffs) n/a
2 ccsbBroad304_11288 pLX_304 0% 19.6% 20.1% V5 (many diffs) n/a
3 TRCN0000470462 CGCGCTGGCGATCTTAACCCATCA pLX_317 41.9% 19.6% 20.1% V5 (many diffs) n/a
Download CSV