Transcript: Mouse XM_006517158.3

PREDICTED: Mus musculus paired-like homeodomain transcription factor 1 (Pitx1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pitx1 (18740)
Length:
2271
CDS:
299..1246

Additional Resources:

NCBI RefSeq record:
XM_006517158.3
NBCI Gene record:
Pitx1 (18740)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517158.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421329 CCTCAACCCGTGAACTGAATG pLKO_005 1663 3UTR 100% 10.800 15.120 N Pitx1 n/a
2 TRCN0000419033 GATCGTTCACCCGGTCAAGAA pLKO_005 1705 3UTR 100% 4.950 6.930 N Pitx1 n/a
3 TRCN0000054656 GCTCAACGCTTGCCAGTACAA pLKO.1 1219 CDS 100% 4.950 6.930 N Pitx1 n/a
4 TRCN0000054655 CGACGCTGATCTGCCAGACAA pLKO.1 451 CDS 100% 1.650 2.310 N Pitx1 n/a
5 TRCN0000020463 CTCGGGCCTCAACAACATCAA pLKO.1 1018 CDS 100% 4.950 3.465 N PITX1 n/a
6 TRCN0000054653 GCTCTCCTCTCAATCCATGTT pLKO.1 922 CDS 100% 4.950 3.465 N Pitx1 n/a
7 TRCN0000054657 CATGAGCATGAGAGAGGAGAT pLKO.1 646 CDS 100% 4.050 2.835 N Pitx1 n/a
8 TRCN0000054654 GTCTACCAAGAGCTTTACCTT pLKO.1 883 CDS 100% 3.000 2.100 N Pitx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517158.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01209 pDONR223 100% 91.2% 96.5% None (many diffs) n/a
2 ccsbBroad304_01209 pLX_304 0% 91.2% 96.5% V5 (many diffs) n/a
3 TRCN0000470178 AACCTTAGACTCTTCCGCTCCCTT pLX_317 36.6% 91.2% 96.5% V5 (many diffs) n/a
Download CSV