Transcript: Mouse XM_006517166.2

PREDICTED: Mus musculus ubiquitin interaction motif containing 1 (Uimc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uimc1 (20184)
Length:
2874
CDS:
447..2630

Additional Resources:

NCBI RefSeq record:
XM_006517166.2
NBCI Gene record:
Uimc1 (20184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304713 GCTTTCCGGTCACGAACTAAA pLKO_005 2580 CDS 100% 13.200 18.480 N Uimc1 n/a
2 TRCN0000304712 TGATCGTGTTCATTAAGTATA pLKO_005 2674 3UTR 100% 13.200 18.480 N Uimc1 n/a
3 TRCN0000304765 GGCGATAAGCAGGTTGCTAAT pLKO_005 1902 CDS 100% 10.800 15.120 N Uimc1 n/a
4 TRCN0000125321 CCCACAAAGATTGAACAGCAT pLKO.1 2010 CDS 100% 2.640 3.696 N Uimc1 n/a
5 TRCN0000125320 GCACTCAGAAACCAAGGATTT pLKO.1 1553 CDS 100% 10.800 8.640 N Uimc1 n/a
6 TRCN0000060429 CCATTGCTGAAAGCCTGAATA pLKO.1 784 CDS 100% 13.200 9.240 N UIMC1 n/a
7 TRCN0000299976 CCATTGCTGAAAGCCTGAATA pLKO_005 784 CDS 100% 13.200 9.240 N UIMC1 n/a
8 TRCN0000304767 TTTGAGAATGAGAACGTTAAA pLKO_005 1071 CDS 100% 13.200 9.240 N Uimc1 n/a
9 TRCN0000125322 CTGGAGTAGATCCCAATCAAT pLKO.1 1300 CDS 100% 5.625 3.938 N Uimc1 n/a
10 TRCN0000331847 CTGGAGTAGATCCCAATCAAT pLKO_005 1300 CDS 100% 5.625 3.938 N Uimc1 n/a
11 TRCN0000125323 CTGCTGAACTATCTTCACATT pLKO.1 850 CDS 100% 4.950 3.465 N Uimc1 n/a
12 TRCN0000125319 CCCATTCAGTATCCTGGCTTT pLKO.1 2748 3UTR 100% 4.050 2.835 N Uimc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12013 pDONR223 100% 63.5% 56.3% None (many diffs) n/a
2 ccsbBroad304_12013 pLX_304 0% 63.5% 56.3% V5 (many diffs) n/a
3 TRCN0000477654 AACCACGTCATAGCAGGAAAACCG pLX_317 27.3% 63.5% 56.3% V5 (many diffs) n/a
Download CSV