Transcript: Mouse XM_006517178.3

PREDICTED: Mus musculus solute carrier family 34 (sodium phosphate), member 1 (Slc34a1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc34a1 (20505)
Length:
1844
CDS:
52..1401

Additional Resources:

NCBI RefSeq record:
XM_006517178.3
NBCI Gene record:
Slc34a1 (20505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517178.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069516 CCTTATCACAAGAGCCACCTT pLKO.1 1254 CDS 100% 2.640 3.696 N Slc34a1 n/a
2 TRCN0000069514 GCCTTTGTGGTGCTTGTTAAT pLKO.1 1138 CDS 100% 13.200 9.240 N Slc34a1 n/a
3 TRCN0000069517 CCTGAGGAATCACAGTCTCAT pLKO.1 372 CDS 100% 4.950 3.465 N Slc34a1 n/a
4 TRCN0000069513 GCAACCATATCTTCGTGGATA pLKO.1 488 CDS 100% 4.950 2.970 N Slc34a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517178.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06968 pDONR223 100% 61.5% 65.8% None (many diffs) n/a
2 ccsbBroad304_06968 pLX_304 0% 61.5% 65.8% V5 (many diffs) n/a
3 TRCN0000474755 GTAAGGTGCCATCCTTACCCCAAG pLX_317 16.7% 61.5% 65.8% V5 (many diffs) n/a
Download CSV