Transcript: Mouse XM_006517187.1

PREDICTED: Mus musculus PAP associated domain containing 7 (Papd7), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Papd7 (210106)
Length:
4217
CDS:
55..2253

Additional Resources:

NCBI RefSeq record:
XM_006517187.1
NBCI Gene record:
Papd7 (210106)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377473 ACTACCGGAGGTGGATCAAAG pLKO_005 1661 CDS 100% 10.800 15.120 N TENT4A n/a
2 TRCN0000053035 CGGATCGAAACTGTGGTGAAA pLKO.1 832 CDS 100% 4.950 6.930 N TENT4A n/a
3 TRCN0000071247 CCGTGCTCCATCAAAGTTCTT pLKO.1 1009 CDS 100% 4.950 3.960 N Papd7 n/a
4 TRCN0000071243 CCTTGACAACAGGATTAAGAT pLKO.1 1716 CDS 100% 5.625 3.938 N Papd7 n/a
5 TRCN0000071246 GTGTTTGACTACGCTTACATT pLKO.1 1540 CDS 100% 5.625 3.938 N Papd7 n/a
6 TRCN0000071244 CCATTACAGTTGTTGGAACAA pLKO.1 961 CDS 100% 4.950 3.465 N Papd7 n/a
7 TRCN0000071245 TGAAGGCTGTTCACAGTGTAA pLKO.1 1976 CDS 100% 4.950 3.465 N Papd7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02605 pDONR223 100% 54.4% 59.4% None (many diffs) n/a
2 ccsbBroad304_02605 pLX_304 0% 54.4% 59.4% V5 (many diffs) n/a
3 TRCN0000469345 TTTTTCCTTGTAATGGAGCAAATT pLX_317 17.8% 54.4% 59.4% V5 (many diffs) n/a
4 ccsbBroadEn_07732 pDONR223 100% 54.3% 59.4% None (many diffs) n/a
5 ccsbBroad304_07732 pLX_304 0% 54.3% 59.4% V5 (many diffs) n/a
6 TRCN0000475778 ACCTAGCGGCTTCTTATGCTTCAA pLX_317 21.2% 54.3% 59.4% V5 (many diffs) n/a
Download CSV