Transcript: Mouse XM_006517246.3

PREDICTED: Mus musculus zinc finger protein 874a (Zfp874a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp874a (238692)
Length:
3193
CDS:
55..1404

Additional Resources:

NCBI RefSeq record:
XM_006517246.3
NBCI Gene record:
Zfp874a (238692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085663 CGCCTGTAATAATGTCTCTTA pLKO.1 2088 3UTR 100% 4.950 6.930 N Zfp874a n/a
2 TRCN0000085664 CATTCCATAGACATTTCCCAT pLKO.1 1372 CDS 100% 2.640 2.112 N Zfp874a n/a
3 TRCN0000085665 CATTTCCCATGAGTGTGTATA pLKO.1 1383 CDS 100% 13.200 9.240 N Zfp874a n/a
4 TRCN0000085667 AGACATCAAATCCATTCCATA pLKO.1 1360 CDS 100% 4.950 3.465 N Zfp874a n/a
5 TRCN0000085666 CCAAGGATCTTCGGGTGTGAA pLKO.1 240 CDS 100% 4.950 3.465 N Zfp874a n/a
6 TRCN0000015885 GCAATTCATACTGGAGAGAAA pLKO.1 697 CDS 100% 4.950 2.970 N ZNF702P n/a
7 TRCN0000419138 ACAACAGGCAATGAATTTAAC pLKO_005 292 CDS 100% 13.200 6.600 Y Zfp874a n/a
8 TRCN0000420991 AGTGTGAAGAGTGTGGAAATT pLKO_005 725 CDS 100% 13.200 6.600 Y Zfp874a n/a
9 TRCN0000425337 CAATTCATACTGGAGTTAAAC pLKO_005 1034 CDS 100% 13.200 6.600 Y Zfp874a n/a
10 TRCN0000420675 GATGTGATGCTGGAGAATTTC pLKO_005 154 CDS 100% 13.200 6.600 Y Zfp874a n/a
11 TRCN0000422844 GCCTTTCTTCATCACTCATAT pLKO_005 661 CDS 100% 13.200 6.600 Y Zfp874a n/a
12 TRCN0000418176 TGAAGAATGTGGGAAAGTATT pLKO_005 813 CDS 100% 13.200 6.600 Y Zfp874a n/a
13 TRCN0000436641 AGTGTCAAGAATGTGGCAAAT pLKO_005 893 CDS 100% 10.800 5.400 Y Zfp874a n/a
14 TRCN0000424972 CATTGATCACAGCTCTCTAAG pLKO_005 327 CDS 100% 10.800 5.400 Y Zfp874a n/a
15 TRCN0000415116 GAGAGGAACCCTACTACTTTG pLKO_005 374 CDS 100% 10.800 5.400 Y Zfp874a n/a
16 TRCN0000436450 TAGTTCTCAGGCAACACTTTC pLKO_005 414 CDS 100% 10.800 5.400 Y Zfp874a n/a
17 TRCN0000147979 GCAATTCATACTGGAGAGAAT pLKO.1 697 CDS 100% 4.950 2.970 N ZNF321P n/a
18 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 707 CDS 100% 13.200 6.600 Y Zfp934 n/a
19 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 707 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
20 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 707 CDS 100% 13.200 6.600 Y EG668616 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.