Transcript: Mouse XM_006517259.3

PREDICTED: Mus musculus zinc finger protein 346 (Zfp346), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp346 (26919)
Length:
3442
CDS:
38..1006

Additional Resources:

NCBI RefSeq record:
XM_006517259.3
NBCI Gene record:
Zfp346 (26919)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517259.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304859 ATGGCTCAGCAACATTATATG pLKO_005 716 CDS 100% 13.200 18.480 N Zfp346 n/a
2 TRCN0000304800 GTGCAGGCTTGCTAGGTATAG pLKO_005 1425 3UTR 100% 10.800 15.120 N Zfp346 n/a
3 TRCN0000099258 AGATGCTAGACCCAGACAAAT pLKO.1 657 CDS 100% 13.200 9.240 N Zfp346 n/a
4 TRCN0000348955 GTCTCAGAAGCTGGCGCATTA pLKO_005 328 CDS 100% 10.800 7.560 N Zfp346 n/a
5 TRCN0000099255 CCTCTCTTATATCCGAAGAAT pLKO.1 1087 3UTR 100% 5.625 3.938 N Zfp346 n/a
6 TRCN0000099259 AGTGAAGAGATACCTAGCAAT pLKO.1 373 CDS 100% 4.950 3.465 N Zfp346 n/a
7 TRCN0000316265 AGTGAAGAGATACCTAGCAAT pLKO_005 373 CDS 100% 4.950 3.465 N Zfp346 n/a
8 TRCN0000099256 CTCAAACTCATGGCACACTAT pLKO.1 767 CDS 100% 4.950 3.465 N Zfp346 n/a
9 TRCN0000316330 CTCAAACTCATGGCACACTAT pLKO_005 767 CDS 100% 4.950 3.465 N Zfp346 n/a
10 TRCN0000099257 GAGGCTAGACTCAGATCAGAA pLKO.1 427 CDS 100% 4.950 3.465 N Zfp346 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517259.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02797 pDONR223 100% 80.6% 76.7% None (many diffs) n/a
2 ccsbBroad304_02797 pLX_304 0% 80.6% 76.7% V5 (many diffs) n/a
3 TRCN0000468508 CTTGTGGTGCACCTCTCTAACCGC pLX_317 31.8% 80.6% 76.7% V5 (many diffs) n/a
Download CSV