Transcript: Mouse XM_006517454.3

PREDICTED: Mus musculus creatine kinase, mitochondrial 2 (Ckmt2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ckmt2 (76722)
Length:
881
CDS:
123..797

Additional Resources:

NCBI RefSeq record:
XM_006517454.3
NBCI Gene record:
Ckmt2 (76722)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024566 CCACTGGTTACCTGCTGAATA pLKO.1 202 CDS 100% 13.200 9.240 N Ckmt2 n/a
2 TRCN0000024564 CCAGGGTGATCTCAATGGAAA pLKO.1 842 3UTR 100% 4.950 3.465 N Ckmt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00315 pDONR223 100% 46.4% 49.4% None (many diffs) n/a
2 ccsbBroad304_00315 pLX_304 0% 46.4% 49.4% V5 (many diffs) n/a
3 TRCN0000491337 CAGTATGCTTATTATAATTAGTCT pLX_317 26.3% 46.4% 49.4% V5 (many diffs) n/a
4 ccsbBroadEn_14586 pDONR223 0% 46.4% 49.4% None (many diffs) n/a
5 ccsbBroad304_14586 pLX_304 0% 46.4% 49.4% V5 (many diffs) n/a
6 TRCN0000480045 GTCAGCAACGCCTGAAGGCTCGAC pLX_317 26.3% 46.4% 49.4% V5 (many diffs) n/a
Download CSV