Transcript: Mouse XM_006517476.3

PREDICTED: Mus musculus endoplasmic reticulum aminopeptidase 1 (Erap1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Erap1 (80898)
Length:
4966
CDS:
366..3158

Additional Resources:

NCBI RefSeq record:
XM_006517476.3
NBCI Gene record:
Erap1 (80898)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517476.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305723 CTCGCATGTGTGCGCAATTAT pLKO_005 2532 CDS 100% 15.000 21.000 N Erap1 n/a
2 TRCN0000031122 GCTTGTATTCTGAATATGCTA pLKO.1 1656 CDS 100% 3.000 4.200 N Erap1 n/a
3 TRCN0000324289 GCTTGTATTCTGAATATGCTA pLKO_005 1656 CDS 100% 3.000 4.200 N Erap1 n/a
4 TRCN0000031119 CGTGGGAATGAATGGCTATTA pLKO.1 2135 CDS 100% 13.200 9.240 N Erap1 n/a
5 TRCN0000324288 CGTGGGAATGAATGGCTATTA pLKO_005 2135 CDS 100% 13.200 9.240 N Erap1 n/a
6 TRCN0000305722 TGCCTTGCAGGATCCACTTAA pLKO_005 3567 3UTR 100% 13.200 9.240 N Erap1 n/a
7 TRCN0000031123 CGTCCATAGCTCACATGGTAA pLKO.1 2938 CDS 100% 4.950 3.465 N Erap1 n/a
8 TRCN0000324260 CGTCCATAGCTCACATGGTAA pLKO_005 2938 CDS 100% 4.950 3.465 N Erap1 n/a
9 TRCN0000031120 CCTTGGAATAATATGCGACTT pLKO.1 474 CDS 100% 4.050 2.835 N Erap1 n/a
10 TRCN0000031121 GCGCTATTTCAGAGAGTGGAA pLKO.1 2576 CDS 100% 2.640 1.848 N Erap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517476.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03378 pDONR223 100% 84.9% 84.2% None (many diffs) n/a
2 ccsbBroad304_03378 pLX_304 0% 84.9% 84.2% V5 (many diffs) n/a
3 TRCN0000477517 AATGCAGTCTCAATCATATTCTAT pLX_317 16.4% 84.9% 84.2% V5 (many diffs) n/a
Download CSV