Transcript: Mouse XM_006517566.3

PREDICTED: Mus musculus occludin (Ocln), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ocln (18260)
Length:
4151
CDS:
276..1841

Additional Resources:

NCBI RefSeq record:
XM_006517566.3
NBCI Gene record:
Ocln (18260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517566.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120880 CGGAAAGAGTTGACAGTCCAA pLKO.1 1216 CDS 100% 2.640 2.112 N Ocln n/a
2 TRCN0000120881 GCTCATTATTGTGATGTGCAT pLKO.1 485 CDS 100% 2.640 2.112 N Ocln n/a
3 TRCN0000159414 GCTCATTATTGTGATGTGCAT pLKO.1 485 CDS 100% 2.640 2.112 N OCLN n/a
4 TRCN0000120877 GCTCATTTGATGTCATTAGTA pLKO.1 2896 3UTR 100% 5.625 3.938 N Ocln n/a
5 TRCN0000120878 CGAAGAAAGATGGATCGGTAT pLKO.1 1071 CDS 100% 4.050 2.835 N Ocln n/a
6 TRCN0000120879 GCTATGGCTATGGCGGATATA pLKO.1 643 CDS 100% 13.200 7.920 N Ocln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517566.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06667 pDONR223 100% 85.8% 89.6% None (many diffs) n/a
2 ccsbBroad304_06667 pLX_304 0% 85.8% 89.6% V5 (many diffs) n/a
3 TRCN0000469640 GCATCCATCTACTCGCACACCTTC pLX_317 27.2% 85.8% 89.6% V5 (many diffs) n/a
Download CSV