Transcript: Mouse XM_006517741.3

PREDICTED: Mus musculus RAB3C, member RAS oncogene family (Rab3c), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab3c (67295)
Length:
8428
CDS:
141..800

Additional Resources:

NCBI RefSeq record:
XM_006517741.3
NBCI Gene record:
Rab3c (67295)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517741.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382088 GTTATGCCGACGATTCCTTTA pLKO_005 262 CDS 100% 10.800 15.120 N Rab3c n/a
2 TRCN0000380156 AGCACGGTTGGCATCGATTTC pLKO_005 297 CDS 100% 10.800 8.640 N Rab3c n/a
3 TRCN0000381147 AGTTGCTGATCATTGGCAATA pLKO_005 211 CDS 100% 10.800 8.640 N Rab3c n/a
4 TRCN0000089454 CGATTCCTTTACATCTGCATT pLKO.1 272 CDS 100% 4.950 3.960 N Rab3c n/a
5 TRCN0000380524 AGAGAATCAAGCTTCAGATTT pLKO_005 346 CDS 100% 13.200 9.240 N RAB3C n/a
6 TRCN0000089457 TGTTCCGTTATGCCGACGATT pLKO.1 256 CDS 100% 4.950 3.465 N Rab3c n/a
7 TRCN0000089453 CCTGTGTTAATATGTGGCAAA pLKO.1 955 3UTR 100% 4.050 2.835 N Rab3c n/a
8 TRCN0000089455 GATAACATCAACGTGAAGCAA pLKO.1 642 CDS 100% 3.000 2.100 N Rab3c n/a
9 TRCN0000089456 CCCAGGTTATCCTGGCTGGAA pLKO.1 523 CDS 100% 0.088 0.062 N Rab3c n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6900 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517741.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478933 TTTATCGGTGCGTTTGGGGAAGTC pLX_317 55.4% 86% 93.8% V5 (many diffs) n/a
2 ccsbBroadEn_09423 pDONR223 100% 85.9% 93.3% None (many diffs) n/a
3 ccsbBroad304_09423 pLX_304 0% 85.9% 93.3% V5 (many diffs) n/a
Download CSV