Transcript: Mouse XM_006517984.1

PREDICTED: Mus musculus PX domain containing serine/threonine kinase (Pxk), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pxk (218699)
Length:
2749
CDS:
288..1787

Additional Resources:

NCBI RefSeq record:
XM_006517984.1
NBCI Gene record:
Pxk (218699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026966 CCGATCCTACTTCACACAATT pLKO.1 989 CDS 100% 13.200 18.480 N Pxk n/a
2 TRCN0000363379 CCGTCCTTCCCACTCTATTAT pLKO_005 2122 3UTR 100% 15.000 12.000 N Pxk n/a
3 TRCN0000378549 GCAGCACTGTTTGGGTATTAT pLKO_005 2021 3UTR 100% 15.000 10.500 N Pxk n/a
4 TRCN0000027007 GCTCAGTTCCATCCAGAATTT pLKO.1 1706 CDS 100% 13.200 9.240 N Pxk n/a
5 TRCN0000026967 CCCAAACAACTATTCTGCAAA pLKO.1 398 CDS 100% 4.950 3.465 N Pxk n/a
6 TRCN0000026987 CGGCAGATATTAGAGGCACTA pLKO.1 846 CDS 100% 4.050 2.835 N Pxk n/a
7 TRCN0000001801 GTCTAATCAAACTTCTGCCTT pLKO.1 625 CDS 100% 2.640 1.848 N PXK n/a
8 TRCN0000342361 GTCTAATCAAACTTCTGCCTT pLKO_005 625 CDS 100% 2.640 1.848 N PXK n/a
9 TRCN0000195613 CGGCTCTTACAGATGCCATTA pLKO.1 1203 CDS 100% 10.800 6.480 N PXK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12106 pDONR223 100% 55.8% 60.1% None (many diffs) n/a
2 ccsbBroad304_12106 pLX_304 0% 55.8% 60.1% V5 (many diffs) n/a
3 TRCN0000471464 CGATAACATCTCGACTATGCAATA pLX_317 35.6% 55.8% 60.1% V5 (many diffs) n/a
4 ccsbBroadEn_15084 pDONR223 0% 55.8% 60.1% None (many diffs) n/a
5 ccsbBroad304_15084 pLX_304 0% 55.8% 60.1% V5 (many diffs) n/a
6 TRCN0000465367 CCCCCTCCTCTAAACAATTGGTAC pLX_317 14.5% 55.8% 60.1% V5 (many diffs) n/a
Download CSV