Transcript: Mouse XM_006518704.1

PREDICTED: Mus musculus lymphocyte cytosolic protein 1 (Lcp1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Lcp1 (18826)
Length:
3511
CDS:
124..2007

Additional Resources:

NCBI RefSeq record:
XM_006518704.1
NBCI Gene record:
Lcp1 (18826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413708 CATTGGGTGCCACGTGGTTAA pLKO_005 732 CDS 100% 10.800 15.120 N Lcp1 n/a
2 TRCN0000011824 GCGATGGCATAGTTCTTTGTA pLKO.1 596 CDS 100% 5.625 7.875 N Lcp1 n/a
3 TRCN0000422945 ACTGGTAGTCAAGGATATAAA pLKO_005 2323 3UTR 100% 15.000 12.000 N Lcp1 n/a
4 TRCN0000011825 CCTGTTGATTGGAACAGAGTA pLKO.1 1429 CDS 100% 0.495 0.396 N Lcp1 n/a
5 TRCN0000424350 TGAACCTTGGAGACATTATTT pLKO_005 2109 3UTR 100% 15.000 10.500 N Lcp1 n/a
6 TRCN0000427380 ATCAGCTGCAATGAGCTAAAT pLKO_005 208 CDS 100% 13.200 9.240 N Lcp1 n/a
7 TRCN0000011823 GCCAAGTAGCTTCTGCTATAA pLKO.1 2150 3UTR 100% 13.200 9.240 N Lcp1 n/a
8 TRCN0000414732 TCCCGGTTCTGGATCTCATTG pLKO_005 1772 CDS 100% 10.800 7.560 N Lcp1 n/a
9 TRCN0000056496 GTCATCAAGATTGGGTTGTTT pLKO.1 814 CDS 100% 5.625 3.938 N LCP1 n/a
10 TRCN0000011826 CGAGTGAGAGAAATCACAGAA pLKO.1 268 CDS 100% 4.950 3.465 N Lcp1 n/a
11 TRCN0000011827 CCGAACTCTCACGCTGGCATT pLKO.1 1584 CDS 100% 1.350 0.945 N Lcp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06517 pDONR223 100% 89.4% 96.9% None (many diffs) n/a
2 ccsbBroad304_06517 pLX_304 0% 89.4% 96.9% V5 (many diffs) n/a
3 TRCN0000474511 AGTCCACCCGGTGTGAGGAGTATT pLX_317 30.2% 89.4% 96.9% V5 (many diffs) n/a
Download CSV