Transcript: Mouse XM_006519017.3

PREDICTED: Mus musculus LIM domain binding 3 (Ldb3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ldb3 (24131)
Length:
4946
CDS:
144..2198

Additional Resources:

NCBI RefSeq record:
XM_006519017.3
NBCI Gene record:
Ldb3 (24131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108691 CGGTGTTACGAGCAGTTCTTT pLKO.1 1812 CDS 100% 5.625 7.875 N Ldb3 n/a
2 TRCN0000428037 GGCAGTTATGGAGGATCTAAA pLKO_005 2559 3UTR 100% 13.200 9.240 N Ldb3 n/a
3 TRCN0000108693 CCCGATCTGTGCCAAATGTAA pLKO.1 1835 CDS 100% 5.625 3.938 N Ldb3 n/a
4 TRCN0000108694 CGGGACAGAATACATGCAAGA pLKO.1 863 CDS 100% 4.050 2.835 N Ldb3 n/a
5 TRCN0000108692 CCTCACTCTACAGAAGTCCAA pLKO.1 374 CDS 100% 2.640 1.848 N Ldb3 n/a
6 TRCN0000108690 GCTCCTGCTACTGATGACGAA pLKO.1 2233 3UTR 100% 2.640 1.848 N Ldb3 n/a
7 TRCN0000437793 GGTCAGCCATTCTACTCTAAG pLKO_005 2130 CDS 100% 10.800 6.480 N Ldb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07762 pDONR223 100% 36.3% 36.1% None (many diffs) n/a
2 ccsbBroad304_07762 pLX_304 0% 36.3% 36.1% V5 (many diffs) n/a
3 TRCN0000472162 TCCCTGTATGCGACTCTTCCCAAT pLX_317 57.1% 36.3% 36.1% V5 (many diffs) n/a
Download CSV