Transcript: Mouse XM_006519248.2

PREDICTED: Mus musculus ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) (Uchl3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uchl3 (50933)
Length:
1125
CDS:
71..985

Additional Resources:

NCBI RefSeq record:
XM_006519248.2
NBCI Gene record:
Uchl3 (50933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030716 CCTGTGGAACGATTGGACTAA pLKO.1 450 CDS 100% 4.950 3.465 N Uchl3 n/a
2 TRCN0000030715 CCTGAACTTCTTAGCATGGTA pLKO.1 284 CDS 100% 3.000 2.100 N Uchl3 n/a
3 TRCN0000030718 GCATGGTACCAAGACCAGTAT pLKO.1 297 CDS 100% 0.000 0.000 N Uchl3 n/a
4 TRCN0000030717 CCCTGATGAGTTAAGATTTAA pLKO.1 940 CDS 100% 15.000 7.500 Y Uchl3 n/a
5 TRCN0000030714 TCTTGACAGAAACACCAAATA pLKO.1 988 3UTR 100% 13.200 6.600 Y Uchl3 n/a
6 TRCN0000030733 CCTGGAGAACTATGACGCTAT pLKO.1 580 CDS 100% 4.050 2.025 Y Uchl4 n/a
7 TRCN0000030732 CCAACCAGTTTCTCAAGCAAT pLKO.1 216 CDS 100% 4.950 2.475 Y Uchl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01745 pDONR223 100% 68.4% 74.3% None (many diffs) n/a
2 ccsbBroad304_01745 pLX_304 0% 68.4% 74.3% V5 (many diffs) n/a
Download CSV