Transcript: Mouse XM_006519353.2

PREDICTED: Mus musculus nischarin (Nisch), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nisch (64652)
Length:
7882
CDS:
3999..7244

Additional Resources:

NCBI RefSeq record:
XM_006519353.2
NBCI Gene record:
Nisch (64652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162969 GCCTGTTGACAAGGACTTCTA pLKO.1 6587 CDS 100% 4.950 6.930 N NISCH n/a
2 TRCN0000173802 CCAGCATCTCAACGTCATCAA pLKO.1 5204 CDS 100% 4.950 3.960 N Nisch n/a
3 TRCN0000419067 CACTATCCATTGCCTGAATTT pLKO_005 6894 CDS 100% 13.200 9.240 N Nisch n/a
4 TRCN0000422029 CCTTGGTTCCTACATTGATTG pLKO_005 7350 3UTR 100% 10.800 7.560 N Nisch n/a
5 TRCN0000163146 GCTGAGAACCGCTACTTTGAA pLKO.1 4413 CDS 100% 5.625 3.938 N NISCH n/a
6 TRCN0000194415 CCTCAGCATCTTACTGTACAT pLKO.1 6761 CDS 100% 4.950 3.465 N Nisch n/a
7 TRCN0000173467 GAAGTGTTAAGTCCAGTCCTT pLKO.1 7608 3UTR 100% 2.640 1.848 N Nisch n/a
8 TRCN0000173590 GCTGTGTACTTCATACTGCAT pLKO.1 6285 CDS 100% 2.640 1.584 N Nisch n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07768 pDONR223 100% 53.6% 55.5% None (many diffs) n/a
2 ccsbBroad304_07768 pLX_304 0% 53.6% 55.5% V5 (many diffs) n/a
3 TRCN0000476629 CCAAAACAGGGGTCACAGGAATCA pLX_317 8.3% 53.6% 55.5% V5 (many diffs) n/a
Download CSV