Transcript: Mouse XM_006519453.2

PREDICTED: Mus musculus ectonucleoside triphosphate diphosphohydrolase 4 (Entpd4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Entpd4 (67464)
Length:
3010
CDS:
242..2059

Additional Resources:

NCBI RefSeq record:
XM_006519453.2
NBCI Gene record:
Entpd4 (67464)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081387 GCTGTCAAAGGACAAGAAATT pLKO.1 421 CDS 100% 13.200 6.600 Y Entpd4 n/a
2 TRCN0000081383 CCCTTTCCTTTCTGTTACAAA pLKO.1 2147 3UTR 100% 5.625 2.813 Y Entpd4 n/a
3 TRCN0000081384 GCGGTTGTGGAAGTCAACATT pLKO.1 977 CDS 100% 5.625 2.813 Y Entpd4 n/a
4 TRCN0000081385 CCACTTCCAGAACAGTGAATT pLKO.1 1480 CDS 100% 0.000 0.000 Y Entpd4 n/a
5 TRCN0000081386 CGAATTCTGAACACCAATTTA pLKO.1 314 CDS 100% 0.000 0.000 Y Entpd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11392 pDONR223 100% 80.1% 81% None (many diffs) n/a
2 ccsbBroad304_11392 pLX_304 0% 80.1% 81% V5 (many diffs) n/a
3 TRCN0000474975 GGTCCTGAGCATTCGGAGTGCCAC pLX_317 32.7% 80.1% 81% V5 (many diffs) n/a
Download CSV